1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nastasia [14]
3 years ago
13

What is the term used to describe the number of individuals moving into a population?

Biology
2 answers:
Minchanka [31]3 years ago
8 0
The term used to describe the number of individuals moving into a population is Immigration.
Mice21 [21]3 years ago
5 0
The answer to the question is metropolitan
You might be interested in
Compared to farms of 100 years ago modern agribusinesses need
aliya0001 [1]

fewer workers.

Hope this helps!



5 0
3 years ago
approximately how far away is the epicenter for an earthquake if the p-waves arrive three minutes 20 seconds before the S Wave​
tekilochka [14]

Answer:

Only P-waves were recorded at seismic station C because P-waves travel At different avival times

Explanation:

....

7 0
3 years ago
In a population of rabbits, there are 496 black rabbits and 27 white rabbits. Fur color is determined by a pair of alleles where
Troyanec [42]

Answer:

0.96

Explanation:

It is given that

B is the dominant allele which represents the black color

and b is the recessive allele which represents the white fur.

B being dominant will result into black color fur for genotype "Bb"

Given -

Frequency of black fur allele (p) is 0.8

As per Hardy Weinberg's  first law of equilibrium

p + q = 1\\

Substituting the value of p in above equation, we get -

q = 1-p\\q = 1-0.8\\q= 0.2

q represents the frequency for white fur allele

Frequency of white fur phenotype is

q^2\\= 0.2^2\\= 0.04

Frequency of homozygous black fur phenotype (BB) is

p^2\\= 0.8^2\\= 0.64

As per Hardy Weinberg's second law of equilibrium -

p^2 + q^2 + 2pq = 1\\0.64 + 0.04 + 2pq = 1\\2pq = 1 - 0.68\\2pq = 0.32\\

Combined frequency of homozygous and heterozygous black fur phenotype is

0.64 + 0.32\\= 0.96

5 0
3 years ago
How is diffusion related to smelling the odor of a skunk that is far away
Margaret [11]
Diffusion is  is like (spreading around), so it wouldn't smell that strong the further away you got... but you would still smell it
7 0
3 years ago
What process is typical of cancer?
Agata [3.3K]

Answer:

D. Uncontrolled Cell Division

Explanation:

Fun Fact: Cancer can make mini cancer that can stack on top of itself.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Your client has been diagnosed with genital warts. Which of the following medications would you anticipate being ordered?
    10·1 answer
  • How far and what direction does the decimal move from centimeters to kilometers?
    10·2 answers
  • Which air pressure reading would be most likely during a clear, sunny day?
    9·1 answer
  • What are the characteristics of high energy waves?
    12·2 answers
  • 12. How many ATP molecules are produced from one glucose molecule during the electron transport chain?
    12·1 answer
  • Which of the following elements is known as "nuclear ash" when it forms inside a star?
    9·1 answer
  • The sun of all possible traits that new offspring of a species could inherit is known as the
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What are gametes? When they go through meiosis are the daughter cells exactly the same or different?
    14·1 answer
  • A woman has two recessive alleles. What is her phenotype? (1 point)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!