1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inn [45]
4 years ago
13

O2 is a molecule. oxygen gas Question 1 options: A) True B) False

Biology
1 answer:
iren2701 [21]4 years ago
5 0
The answer is A) True
You might be interested in
4. Change any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid
ruslelena [56]
Q1) 

the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.

<span>5’ agcggg  atg  agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here 
we change base A to T (capitalised)

DNA sequence with amino acids are given 
</span>5’ agcggg  atg  Tgc gca  tgt  ggc gca taa ctg 3’
N               Met Cys Ala Cys  Gly Ala stop 
after changing the base the amino acid sequence changes from Ser to Cys.

Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts 
</span>5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt  atg  cgc  cac  atg  cgc Aca tcc  cgc t 3'
              Met Arg  His Met  Arg  Thr Ser Arg
amino acid changes from Ser to Thr.

Q3) 
The sequence with amino acids before inserting a base is 
5’ agcggg  atg  agc gca tgt  ggc gca taa ctg 3’
                  Met Ser Ala Cys Gly Ala  stop
We insert a base G shown in capitals 
5’ agcggg  atg  agc Ggca tgt  ggc gca taa ctg 3’

  This changes the codons of bases after the inserted base
5’ agcggg  atg  agc ggc atg  tgg  cgc ata act g 3’
                 Met  Ser Gly Met Trp Arg  Ile  Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
 to   Met  Ser Gly Met Trp Arg  Ile  Thr
                  
Q4)
the complementary strand before adding a base is 
5' cagtt  atg  cgc  cac  atg  cgc tca tcc  cgc t 3'
              Met Arg  His Met Arg  Ser Ser Arg
When we insert a base G, base C is added to the complementary strand 
5' cagtt  atg  cgc  cac  atg  cCgc tca tcc  cgc t 3'
this changes the codons
5' cagtt  atg  cgc  cac  atg  cCg ctc atc ccg ct 3'
              Met Arg His  Met  Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from 
Met Arg  His Met Arg  Ser Ser Arg 
to Met Arg His  Met  Pro Leu Ile Pro
7 0
3 years ago
What are the atomic masses of<br> protons, neutrons, and electrons?
pshichka [43]

Answer:

Protons, neutrons, and electrons: Both protons and neutrons have a mass of 1 amu and are found in the nucleus. However, protons have a charge of +1, and neutrons are uncharged. Electrons have a mass of approximately 0 amu, orbit the nucleus, and have a charge of -1.

Explanation:

5 0
4 years ago
Read 2 more answers
List and describe the layers of the Earth in order from the center to the surface
Svetlanka [38]

The Earth's layers in order from the center to the surface would be The Inner Core, The Outer Core, The Mantle, The Asthenosphere, The Lithosphere, then The Crust.  Hope this helped!

-TTL

8 0
3 years ago
Read 2 more answers
The difference between DNA and RNA is that RNA consists of a double-stranded helix of sugars, phosphate groups, and nitrogenous
balu736 [363]

Answer: The statement is false

Explanation:

It is a false statement because both DNA and RNA could consists of a double-stranded helix of sugars, phosphate groups, and nitrogenous bases.

The major differences however, is that thymine is found only in DNA, while uracil is found only in RNA molecules.

6 0
4 years ago
Botulism is caused by ingestion of a proteinaceous exotoxin; therefore, it can easily be prevented by
hammer [34]

Botulism can easily be prevented by boiling food prior to consumption.

<h3>What is Botulism?</h3>

Botulism may be defined as an imperative food poisoning that is provoked by botulinum toxin delivered in food by a bacterial species clostridium botulinum.

Clostridium botulinum inhibits the release of acetylcholine in the neuromuscular junction and causes defects in sensory perception through the central nervous system.

It can only be prevented by taking the proper boiled food prior to consumption.

The complete question is as follows:

  • boiling food prior to consumption.
  • administering antibiotics to patients.
  • not eating canned food.
  • filtering food.
  • preventing fecal contamination of food.

Therefore, the correct option for this question is A, i.e. boiling food prior to consumption.

To learn more about Food poisoning, refer to the link:

brainly.com/question/2192816

#SPJ1

4 0
2 years ago
Other questions:
  • 4. Jimmy likes to work with his friend Joe in 7th grade science class labs. However, he notices that he tends to get lower grade
    8·1 answer
  • What would happen if the cell membrane were not selectively permeable ? Support your response
    14·1 answer
  • What controls recognition and analysis of body temperature?
    7·1 answer
  • Whats the difference from a reaction with an enzyme and one without
    11·1 answer
  • Which organisms would be more closely related organisms in the same kingdom organisms in the same phylum? Why?
    7·2 answers
  • When an enzyme was added that destroyed carbohydrates from the heat-
    5·1 answer
  • How much of a general sherman tree's weight is carbon
    15·1 answer
  • What will most likely happen if the human population continues to grow and carelessly emit gases? (L17.20)
    7·1 answer
  • Which fossil first linked the evolution of birds from reptiles ? What do we call these links
    12·1 answer
  • Which would cause the body to release less water through the excretory
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!