Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
Answer:
Protons, neutrons, and electrons: Both protons and neutrons have a mass of 1 amu and are found in the nucleus. However, protons have a charge of +1, and neutrons are uncharged. Electrons have a mass of approximately 0 amu, orbit the nucleus, and have a charge of -1.
Explanation:
The Earth's layers in order from the center to the surface would be The Inner Core, The Outer Core, The Mantle, The Asthenosphere, The Lithosphere, then The Crust. Hope this helped!
-TTL
Answer: The statement is false
Explanation:
It is a false statement because both DNA and RNA could consists of a double-stranded helix of sugars, phosphate groups, and nitrogenous bases.
The major differences however, is that thymine is found only in DNA, while uracil is found only in RNA molecules.
Botulism can easily be prevented by boiling food prior to consumption.
<h3>What is Botulism?</h3>
Botulism may be defined as an imperative food poisoning that is provoked by botulinum toxin delivered in food by a bacterial species clostridium botulinum.
Clostridium botulinum inhibits the release of acetylcholine in the neuromuscular junction and causes defects in sensory perception through the central nervous system.
It can only be prevented by taking the proper boiled food prior to consumption.
The complete question is as follows:
- boiling food prior to consumption.
- administering antibiotics to patients.
- not eating canned food.
- filtering food.
- preventing fecal contamination of food.
Therefore, the correct option for this question is A, i.e. boiling food prior to consumption.
To learn more about Food poisoning, refer to the link:
brainly.com/question/2192816
#SPJ1
