1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notka56 [123]
3 years ago
14

What is the one function of steroids

Biology
1 answer:
dalvyx [7]3 years ago
7 0
Afunction of steroids is to increase muscle mass to help you get an advantage on your competitors.
You might be interested in
What four tissues is skin made of
Scilla [17]

Four tissues is skin made of

Simple epithelial, Squamous epithelium,Cuboidal epithelium, Stratified epithelium.

4 0
3 years ago
Read 2 more answers
What codes for proteins?
Tju [1.3M]

Answer:

b

Explanation:

The R in RNA stands for Ribosomes which are proteins.

7 0
3 years ago
What causes wind?
slega [8]

Answer:B

Explanation:

4 0
3 years ago
Read 2 more answers
Which qualities describe the entire open-ocean zone? Check all that apply. few nutrients
uysha [10]

<u>Answer:</u>

- few nutrients

- high pressure

- low temperatures

<u>Explanation:</u>

1. Few nutrients:  open-ocean zone is located way far from the land, which is the main source of the essential nutrients.

2. High pressure: pressure increases by 1 atmosphere for every 10 meters increase in depth.

3. Ample sunlight: a large fraction of the sunlight is reflected back to the atmosphere from the sea surface.

4. Varying salinity: below the thermocline, the water is isolated from the atmosphere so the salinity remains stable over the year.

5. Low temperatures:  the temperature of open-ocean zone ranges from a low of -2°C to an average of 17°C.

8 0
3 years ago
Read 2 more answers
What is Naruto favorite food
jek_recluse [69]

☁️ Answer ☁️

Ramen?

Hope it helps.

Have a nice day noona/hyung.

8 0
3 years ago
Other questions:
  • A company develops a new pesticide that kills insects. When the pesticide is first used, it kills nearly all the insects.
    6·1 answer
  • What determines the viscosity of magma m b
    14·1 answer
  • Which biological macromolecule is the most important and why
    7·1 answer
  • Watson and Crick discovered that DNA is __________. A. the genetic information B. very small C. a double helix D. a treatment fo
    9·2 answers
  • Grasslands with scattered trees is called
    15·2 answers
  • What is dna and where excately is it in your body?​
    14·2 answers
  • Which kind of rock forms when molten rock from underground moves to the
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which lipoprotein picks up cholesterol from your arteries and other places in the body and returns it back to the liver for furt
    15·1 answer
  • What i Photoytem, Noncyclic Pathway, ATP ynthae, Carbon fixation, carbon regeneration, carbon reduction, Calvin Cycle, photorepi
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!