1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olin [163]
3 years ago
11

Some also plz help me with these. I am SO confused!!

Biology
1 answer:
SVEN [57.7K]3 years ago
3 0
?????????????? I am just elementary why are you asking me I took my parents email anyway
You might be interested in
Which of the following statements about comets is true?
Mrrafil [7]

Answer:

D

Explanation:

Comets are brightest near the sun.

7 0
3 years ago
Read 2 more answers
Why does the Ocean appear to be blue?
Oliga [24]

I do believe the answer is B

6 0
3 years ago
Read 2 more answers
What does macromolecule mean? (Apex)
inysia [295]
A molecule containing a very large number of atoms, such as a protein, nucleic acid, or synthetic polymer.

7 0
3 years ago
An organism is homozygous dominant for one trait and heterozygous for another. What is the probability of the organism producing
adell [148]

Answer:

C.1 out of 2

Explanation:

The probability of the organism producing a gamete with one dominant allele and one recessive allele for these trait is 2 out of 4 which can be further reduced to 1 out of 2.

For a cross between Homozygous and heterozygous individual we will get 2 homozygous and 2 hetrerozygous individual. The heterozygous individual has one homozygous allele and one heterozygous allele

4 0
3 years ago
Read 2 more answers
If a scientist is studying the attraction of water molecules to each other, what property is he or she studying?
gtnhenbr [62]

Answer: Cohesion

Explanation:

The cohesive attraction or cohesive forces is the action or property of like molecules which stick together.

It can be intrinsic forces that can be caused by the structure and shape of water. This allows the water molecules to stick to each other.

Due to this phenomenon of water it has a spherical shape and it flows in a liner motion.

Hence, the force that is present between two water molecules is cohesion.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What systems contain the heart
    15·2 answers
  • How does dna help with the transfer of genetic material from parents to offspring? proteins bind to dna, which activates them an
    12·2 answers
  • What is the movement of substances into and out of a cell without the use of energy called?
    6·1 answer
  • Bacteria and bacteriophages are undergoing an evolutionary battle. In particular, phages that infect Salmonella enterica can use
    8·1 answer
  • During photosynthesis, light energy is converted to the energy in chemical bonds. What also happens according to the predictions
    6·2 answers
  • What would happen if DNA did not duplicate during interphase
    11·2 answers
  • Which of the following is a domain consisting of protists, fungi, plants, and animals?
    14·2 answers
  • Are vesicles involved in passive transport? please explain​
    13·1 answer
  • HELP! I will give you brainliest!!!
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!