1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
4 years ago
10

Which of the following is an example of how the industrial revolution contributed to the spread of imperialism?

Biology
2 answers:
bixtya [17]4 years ago
7 0
The answer is A it made it possible to ship goods worldwide
grin007 [14]4 years ago
3 0

Answer:A) it made it possible to ship goods worldwide

Explanation:

You might be interested in
Which types of tissue helps to keep both out blood pressure regulated and our digestive system effective
Tomtit [17]
I’m pretty sure it is Muscle tissue
5 0
3 years ago
Does the heart shaped plant contain the same genetic formation as the leafy plant
allochka39001 [22]

Answer:

no

Explanation:

theyre different shapes. go to bed.

5 0
3 years ago
What do you notice is the main difference between the structure of the connective tissues and the structure of the epithelium? m
FinnZ [79.3K]

The connective tissues and the epithelial tissue differ in their structure in the way their cells are organized. The cell of the epithelial tissue are organized in a closed-packed pattern, while the cells of connective tissue are organized in spread out pattern. Moreover, the connective tissues has blood vessels, but the epithelial tissue does not.

The epithelial tissues serve the purpose of protection. Protective layering is formed by the epithelial tissues in the body. The connective tissue such as bone provides support to the body. The blood vessel connectivity helps in the transfer of the newly formed blood cells.

The appearance of a person is determined by the tissues and other components. The skeletal determines the basic structure of the person. The epithelial tissues give more specificity to the figure of a person. The fats helps in determining the shape of the eyes and cheeks.

The fat in the cheeks is supposed to help the new born infants to suckle and chew. Moreover, it provides padding to the temporalis muscle while chewing. The fat behind the eyes helps in preventing damage to the eyes which may be caused if they rub with the bones of the skull.

It will be hard to open and close one's mouth if the temporalis muscle of a person is damaged. This will make forming words properly difficult. The damage to orbicularis oculi will make the blinking extremely difficult. The facial expressions will be distorted in such cases. The damage to the orbicularis oris will make the movement of the mouth difficult, which will cause poor articulation.


5 0
3 years ago
Ralph is always thirsty and recently learned that he synthesizes mutated antidiuretic hormone (ADH). Discuss why Ralph would be
Varvara68 [4.7K]

Diabetes insipidus is a disease characterized by excessive thirst and the excretion of large amounts of highly diluted urine, which can not be reduced by a reduction in fluid intake.

Diabetes insipidus is due to a deficiency of antidiuretic hormone or insensitivity of the kidneys to this hormone. This hormone causes water reabsorption via action on the distal segment of the nephron during dehydration.

3 0
3 years ago
Can someone please help I’ll mark the brainliest!
Slav-nsk [51]

Answer:

4may be

sry it may be wrong

6 0
3 years ago
Other questions:
  • Complete the diagram pictured on the right by identifying each missing label
    7·2 answers
  • Discuss two ways that all cells are alike?
    12·1 answer
  • A nurse is providing discharge instructions for a client with a diagnosis of gastroesophageal reflux disease (gerd). what should
    13·1 answer
  • What passage carries food between the pharynx and the stomach?
    9·1 answer
  • Hunger is BEST described as: A) a physiological drive to consume food. B) a psychological drive to consume food. C) eating that
    11·1 answer
  • If a person has type B blood, which statement describes the antibodies present in his or her blood?
    12·2 answers
  • A 13 year old growing 2 inches in 1 year mitosis or meiosis
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The following breakfast menu includes foods from various food groups. From the following options, select three good food sources
    15·2 answers
  • What components of an ecosystem are not part of a community
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!