1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
13

Witch characteristics are always present in all living things

Biology
2 answers:
nlexa [21]3 years ago
6 0

They all have either one or more than one cells, they are able to reproduce, their ability to exert waste, and the ability to grow.

Olin [163]3 years ago
4 0

movement, respiration, sensitivity, growth, reproduction, excretion, and nutrition.

You might be interested in
Large doses of antibiotics given to fight an infection are likely to destroy bacteria that produce vitamin K. In which digestive
Gnom [1K]
I'm guessing Liver.
If it was in the stomach, we wouldn't get belly aches. If it were in the large intestine, we wouldn't poop. So that's my guess.
4 0
3 years ago
Which is a component of pseudoscience, but not science?
DENIUS [597]
D). Beliefs are not scientific.
4 0
2 years ago
Read 2 more answers
A metalloid-
sleet_krkn [62]
Im a little late but its B Its a mixture of both  metals and nonmetals

5 0
3 years ago
Read 2 more answers
In a given year, which would result in the greatest increase in population size?
Kay [80]
2. High birth rate, zero death rate, high immigration, zero emigration

This is because birth rate and immigration increase population size, and death rate and emigration decrease population size, so maximizing the former and minimizing the latter are ideal
8 0
2 years ago
Read 2 more answers
The Cells in your body get energy from the foods you eat. However, your cells must use energy to get this energy. Why?
IrinaK [193]
Because so you keep healthy
5 0
2 years ago
Read 2 more answers
Other questions:
  • Whats the difference between a neap tide and a spring tide
    13·2 answers
  • Which is the broadest grouping used in the taxonomic system?
    9·1 answer
  • Pleaseeee help!!!!!!!! I will mark you as brainlinest for correct answer!!!!!!!!!!
    12·2 answers
  • What fraction of the offspring would be expected to have white hair?
    8·1 answer
  • The entropy of a system measures the state of disorder of the system.
    11·2 answers
  • Which factors tend to promote higher biodiversity in an ecosystem? Check all that apply.
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is a black banded sea snake's lifespan? How do they take care of their young? Please explain in details.
    10·1 answer
  • These branching structures carry information towards the cell body of a neuron
    6·1 answer
  • Can anyone please help with these two questions? Thanks!
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!