1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreev551 [17]
3 years ago
12

which would have a better chance of becoming a fossil:a fish that dies and settles to the ocean floor or a mouse that dies on th

e ground in a forest?
Biology
2 answers:
sweet-ann [11.9K]3 years ago
6 0

The mouse; because the fish might decompose much faster, because it would be in water

dedylja [7]3 years ago
6 0

I would say that a fish that died on the ocean floor would become a better fossil, because archaeologists nowadays have discovered many fossil that were preserved quite well in ancient oceans. The fish. Fossils must be quickly buried in an environment free of oxygen where nothing will disturb them. I.e, the ocean floor. The mouse will be open to the elements for ages before plant matter begins to cover it so will have less of a chance.

Hope this help can i get a brainliest please if this helped



You might be interested in
Mr. Jones, the science teacher, tells his students that energy cannot be created; it must be captured from the environment. He i
natta225 [31]
<span>A: food chain

</span><span>In many functions of a living organism, it cannot make its own energy. It uses energy from its environment, retrieves and converts into a usable and edible matter. Organisms that can do this process is the autotrophs, they can facilitate photosynthesis which they gather energy from the sun, water and carbon dioxide in order to create energy by then, the transfer of this energy to other organism is played by the food chain –food web. </span>
6 0
2 years ago
Read 2 more answers
HELP PLEASE!!!!!One of the central themes in biology is how DNA, RNA, and proteins are related. Describe how genetic information
Anna007 [38]
 <span>DNA contains the code for all an organism's protein. Since many of the organism's structures, processes, and growth depend on protein the DNA is central to the well being of all organisms. In eukaryotes, the DNA is locked up in the nucleus. The area of the cell where proteins are made is in the cytosol (ribosomes). In order for the protein to be made the DNA has to produce a copy of the blueprint m-RNA. This messenger RNA will take the code to the ribosome. The process by which m-RNA is made is called transcription. A-U, C-G base pairing rules. Once on the ribosome another RNA comes into play t-RNA. This is called transfer RNA. Here it will take an amino acid and place it in the correct order to produce the desired protein. This is called translation. It begins with a start co don AUG. and ends with a stop codon. The protein will then go to the Golgi apparatus and be formed into its final shape.
HOPE IT HELPS</span>
8 0
2 years ago
In the lab, Celia adds concentrated sulfuric acid to a beaker full of water. She touches the side of the beaker and finds the so
AlladinOne [14]

Answer: The statement is false

Explanation:

Addition of concentrated sulfuric acid (H2SO4) to a beaker full of water (H2O) will release heat energy to the containing vessel due to the breakage of strong ionic bond present in the acid.

Thus, it is an evidence of a EXERGONIC REACTION (since energy is released spontaneously). So, the statement is false

8 0
3 years ago
Charlie has been assigned to write an essay about modern redox reactions. Which pair of resources would BEST help the student le
azamat

Answer:

D) a scientific journal about chemistry and a biography of a famous chemist

7 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Other questions:
  • 1. During RNA processing a(n)___________ is added to the 5' end of the RNA. A. 3' untranslated region. B. a long string of adeni
    10·1 answer
  • What is the main difference between weather and climate? A. Weather refers to temperature and precipitation, whereas climate ref
    14·1 answer
  • Mutations can occur as a result of many factors, including ultraviolet light or environmental pollutants such as pesticides and
    14·2 answers
  • Which process helps to preserve the genetic information stored in DNA during DNA replication?
    8·1 answer
  • Scientific theories are more like laws than hypotheses.<br> True False
    13·1 answer
  • What is the relationship between a cheetah and a deer
    13·1 answer
  • WILL MARK BRAINLIEST! In some plants, the pistils don’t form until a few days after the stamens do. How might this keep a plant
    10·1 answer
  • What is the relation between chromatin ,dna,gene,chromosome?pls answer in simple words ​
    10·1 answer
  • Overfishing in this ecosystem has directly impacted the fish population. If the fish no longer exist in this ecosystem due to ov
    9·1 answer
  • Assume a physiologist has inserted a microelectrode into a neuron when it is at rest. The voltage recorded at the arrow tip will
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!