1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
2 years ago
15

Which is an example of a cartilaginous fish

Biology
1 answer:
Tanya [424]2 years ago
4 0

A Stingray could be an example. A shark could also be an example of a cartilaginous fish. It means any fish with cartilage.

You might be interested in
What is gene therapy?
11Alexandr11 [23.1K]

<u>Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease.</u> <u>Genes contain your DNA the code that controls much of your body's form and function from making you grow taller to regulating your body systems.</u>

5 0
3 years ago
Read 2 more answers
______ are organisms that consume other organisms.
Arlecino [84]

Answer:

Heterotrophs

Explanation:

Autotrophs, producers, and plants all make their own food.

6 0
3 years ago
Read 2 more answers
More than one globular or fibrous protein subunit now interact to produce ____________ structure, which results from ionic, hydr
Gelneren [198K]

Answer;

Quaternary structure

Explanation;

-Amino acids link together end-to-end forming the primary structure of proteins.

-Chemical properties of amino acid groups within a sequence interact with one another in secondary protein structure resulting in hydrogen bonding and chain folding.

-Intramolecular bonding of polypeptide chains produces numerous alpha helices and beta sheets.

-Globular and fibrous shapes are created with tertiary structure of proteins caused by further folding due to disulfide bridges, hydrophobicity and Van der Waals forces.

-More than one globular or fibrous protein subunit now interact to produce quaternary structure, which results from ionic, hydrophilic, and hydrophobic interactions.

7 0
3 years ago
If two populations of people share the same DNA "spelling difference" (i.E., mutation), what does this mean about these two popu
AnnyKZ [126]

Answer:

It could mean that those two populations could be common ancestors because the spelling differences are the same

Explanation:

6 0
3 years ago
Read 2 more answers
How does natural selection lead to evolution?
Novay_Z [31]
C. Helpful variations accumulate among surviving members of a species
8 0
3 years ago
Other questions:
  • Some arctic species like the arctic fox (pictured above) grow white fur only in winter. In summer, it is a brown color. What exp
    12·2 answers
  • This is short for adenosine diphosphate. An organic compound that is composed of adenosine and two phosphate groups. With the ad
    15·2 answers
  • The running of the bulls is a Spanish tradition in which people try to outrun a herd of charging bulls and make it safely to the
    12·2 answers
  • The absorptive effectiveness of the small intestine is enhanced by increasing the surface area of the mucosal lining. Which of t
    10·1 answer
  • Falling action for the movie coco
    8·2 answers
  • The mother of a child has a cleft chin while the father of a child has a smooth chin. The child also has a cleft chin.
    14·1 answer
  • PLEASE HELP I’m begging
    8·1 answer
  • PLEASE HELP!!!! 20 POINTS!!!!
    8·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Cells quiz need help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!