Answer:
Soil Erosion
Explanation:
Basically, tillage breaks soil up, destroying its overall structure. It encourages surface runoff and therefore soil erodes more easily. In some cases soil erosion is beneficial, but in most cases, it is not. Tillage has also been found to cause the emissions of more toxic gases such as N20.
<span>Are mirror images of one another
in science, an enantiomer, otherwise called an optical isomer, where you have two stereoisomers that are perfect representations of each other that are non-superimposable , much as one's left and right hands are the same aside from being turned around along one pivot.</span>
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Option-1 and 3
Explanation:
Cadherin is the protein complex present in the cell which is responsible for the sticking together of cell in tissue-like in the skin. The cadherin junctions allow the communication between the cells and the loss of the cadherin could cause cancer.
The cadherin junction is involved in the signalling pathway in the cells like in the Rho GTPase signalling, Ras signalling and many others which shows that they are responsible for the biological processes in an organism.
Thus, Option-1 and 3 are correct.
Then solution attracts cell material towards itself by the process of osmosis...