1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
2 years ago
13

Paclitaxel affects not only cancer cells, but normal cells as well. Would the effects of Paclitaxel be seen first in organs that

have quickly dividing cells (like the intestine and hair follicles) or in organs that have slow or nondividing cells (like muscles and the nervous system). Justify your reasoning.
Biology
1 answer:
Svetlanka [38]2 years ago
5 0

Answer: The most affected would be organs that have QUICKLY dividing cells (like the intestine and hair follicles).

Explanation:

Cancer cells are cells that divides uncontrollably giving rise to a mass of tissue called tumour. They grow faster than a normal cell in an uncoordinated manner, and continues to grow after the initial stimulus has ceased.

Paclitaxel is a drug that is approved for the treatment of cancer affecting different parts of the body. It's a microtubule-stabilizing drug whose mechanism of action is to induce mitotic arrest in the cancer cells.

Paclitaxel in its cause of action not only affect cancer cells but normal cells as well. To justify this statement, as stated earlier, the mechanism of action of paclitaxel is to induce mitotic arrest. Therefore the cells of organs where rapid mitosis occurs would be most affected. Skin cells, hair follicles and the cells lining our intestines (epithelial cells) all have high rates of mitosis as these tissues constantly need to be replaced.

You might be interested in
Explain how tillage has negative effects on the environment.
Sergeeva-Olga [200]

Answer:

Soil Erosion

Explanation:

Basically, tillage breaks soil up, destroying its overall structure. It encourages surface runoff and therefore soil erodes more easily. In some cases soil erosion is beneficial, but in most cases, it is not. Tillage has also been found to cause the emissions of more toxic gases such as N20.

7 0
3 years ago
Read 2 more answers
Research indicates that ibuprofen a drug used to relieve inflammation and pain is a mixture of two enantiomers that is molecules
sergeinik [125]
<span>Are mirror images of one another
  in science, an enantiomer, otherwise called an optical isomer, where you have two stereoisomers that are perfect representations of each other that are non-superimposable , much as one's left and right hands are the same aside from being turned around along one pivot.</span>
5 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Cadherin clusters of adherens junctions _____________. 1) connect the external environment to the actin cytoskeleton 2) do NOT r
Roman55 [17]

Answer:

Option-1 and 3

Explanation:

Cadherin is the protein complex present in the cell which is responsible for the sticking together of cell in tissue-like in the skin. The cadherin junctions allow the communication between the cells and the loss of the cadherin could cause cancer.

The cadherin junction is involved in the signalling pathway in the cells like in the Rho GTPase signalling, Ras signalling and many others which shows that they are responsible for the biological processes in an organism.

Thus, Option-1 and 3 are correct.

5 0
3 years ago
If the solution outside the cell is hypotonic then solution is
PtichkaEL [24]
Then solution attracts cell material towards itself by the process of osmosis...
5 0
3 years ago
Other questions:
  • Explain the difficulties in developing antiviral drugs against dna viruses, when compared to rna viruses.
    15·1 answer
  • What form of reproduction is shown
    10·1 answer
  • True or false? The liver is a component of the alimentary canal.
    6·1 answer
  • Greenhouse gases are gases that trap heat within the Earth’s atmosphere. What would be the most likely result of an increase in
    7·2 answers
  • A punnet square is shown below. The dominant trait is represented by R. The recessive trait is represented by r. What percentage
    5·1 answer
  • Which of the following is an inference instead of an observation? Please answer correctly and show how it's correct maybe
    9·1 answer
  • Which best describes the cell theory?
    15·1 answer
  • Which of the following sentences best describes osmosis?
    7·1 answer
  • An ecosystem with great biological
    14·1 answer
  • What is metabolism meaning
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!