1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
3 years ago
14

What happens if a penguin population exceeds its carrying capacity?

Biology
2 answers:
masha68 [24]3 years ago
8 0

Answer:

there would be less food than penguin

less area to live

Rina8888 [55]3 years ago
3 0

Answer:

there would be less food than penguin  less area to live

Explanation:

You might be interested in
Most of the oxygen exiting the blood and entering the tissues does so from the ________. most of the oxygen exiting the blood an
mariarad [96]

Most of the oxygen exiting the blood and entering the tissues does so from the capillaries.

Answer: Option D

<u>Explanation:</u>

The circulatory system consists of the heart, arteries, veins and capillaries. An artery is the one which carry blood from the heart to the organs. A vein is the one which carry blood from the organ to the heart.

A capillary is the smallest blood vessel which helps connect the functions of arteries and veins in the body. The capillaries are the narrow tubes which allow diffusion of Oxygen into and from the tissues. It’s prior function is to drop Oxygen in a tissue and collect the Carbon dioxide from the tissue.

4 0
3 years ago
Why is the groin swollen when our toe is injured​
Mazyrski [523]

Answer:

Because when your toe is injured it sends a pulse to your groin that causes your groin to fell pain so your brains neuropathegens dont feel as much pain transmiting through your toe. Hope this helps :)

4 0
3 years ago
So sorry , i will give whoever does all of these brainlist . :)
Orlov [11]

1. constant speed is a steady speed from start to finish, instantaneous is not constant from start to finish.

2. The average speed of the marble is 5 m/s  (meters per second).

3. Rider 1 will arrive at the destination before Rider 2.

Hope This Helps!  : )

6 0
2 years ago
A wolf pack hunts, kills, and feeds on a moose. In this interaction, the wolves are
ch4aika [34]
Hi there, thanks for asking a question here on Brainly.

When a <span>wolf pack hunts, kills and feeds on a moose the wolves are considered predators toward the moose. 

Answer: Predators </span>✅

Hope that helps! ★ If you have further questions about this question or need more help, feel free to comment below or leave me a PM. -UnicornFudge aka Nadia 

4 0
3 years ago
How does a noncompetitive inhibitor decrease the rate of an enzyme reaction?
Wittaler [7]

Answer :B. By changing the shape of the enzyme's active site.

check the attachment

Explanation: This is a type of inhibition , in which a molecule binds to another part of the enzyme instead of the  active site.

On binding, it disrupts the  normal hydrogen bond and hydrophobic   interactions holding the enzyme molecule in its three dimensional shape, therefore distorting the conformation and   ACTIVE SITE of the  enzyme (changed it shape).

Since the active site is the precise location enzyme must bind with substrates for enzymatic reactions,this makes the enzyme not fit  for binding with the substrate, therefore  the efficiency  is reduced. No substrate-enzyme complex, and hence no substrate-product  complex for the release of  products, this brings down the turnover rate and eventually

<u>the rate of reaction of the enzyme</u>

Thus, the enzyme function is totally blocked, even in high concentration of the substrate,

Download docx
4 0
3 years ago
Other questions:
  • When glaciers melt, water is returned to groundwater storage by what means?
    10·2 answers
  • An elderly woman in a nursing home no longer goes outside to enjoy the sunshine and fresh air, has reduced her meat intake becau
    10·2 answers
  • How many calories should a woman burn during sleep?
    11·1 answer
  • Which is not a function of a vacuole?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The species of plasmodium that cause the disease malaria are found in
    9·1 answer
  • Which of these is a base?<br><br> ammonia <br><br> HCI<br><br> vinegar<br><br> HNO 3
    5·1 answer
  • Should people try to save wild populations of the Asian elephant? (Complete sentences says my teacher :/ )
    14·1 answer
  • What is the atomic number of an oxygen atom that has 8 protons in its nucleus?
    13·2 answers
  • The ____ sinus is one of the four ____ sinuses
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!