1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
6

In what way does DNA look like a book

Biology
1 answer:
Marizza181 [45]3 years ago
8 0

In a illistration it kinda looks like a twisty 3D ladder..

You might be interested in
The members of these kingdoms all have cell walls. Which kingdoms are they?
bogdanovich [222]

Answer:

kingdom plantae

Explanation:

members of this kingdom have a cell wall that gives their cells a box like structure

5 0
3 years ago
Read 2 more answers
Help please!!!
nikdorinn [45]

it's b. anaphase and spindle fibres pulls chromosomes towards the centrioles in this phase.

7 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
6.
Juli2301 [7.4K]

My answer to the question is Transpiration pull.

5 0
3 years ago
There are ongoing arguments among taxonomists as to which phyla represent the closest relatives of phylum Annelida. Some propose
NikAS [45]

Answer:

a. the segmented body plan of the annelids

Explanation:

  • lophotrochozoan is a taxonomy of animals that includes annelids, bryozoans, and brachiopods.
  • This taxonomy of creatures was defined in 1995 as the last ancestor of the taxa of worms, mollusks, and annelids. Their classical definition depends on the topology of the spiral tree of life.
  • Annelids have a segmented body part wherein the external morphological features are repeated in every body segment. It allows the animal to become bigger and makes their movement more fat and efficient.
8 0
3 years ago
Read 2 more answers
Other questions:
  • What structure is attached to the nuclear envelope and lined with ribosomes?
    5·2 answers
  • Sheena wants to measure the volume of a ball that is 24 cm across. How should she set up her equation?
    11·2 answers
  • What is homeostasis?
    6·2 answers
  • The _____ Thory of disease asserted that many human diseases were the result of infection with microbes ,as opposed to other non
    6·1 answer
  • What do all members of a biological species have in common?
    6·2 answers
  • The controlled release of cellular material stored in membrane-bound vesicles to the outside of the cell is an example of: Group
    5·1 answer
  • What are the most common fossil types and why?
    8·1 answer
  • How do you think this transfer of electrons helps the lactic acid fermentation process repeat itself?
    5·1 answer
  • PLZ hurry
    14·2 answers
  • Which substance is coded for by A length of dna?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!