1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
14

A primigravid client at 34 weeks' gestation is experiencing contractions every 3 to 4 minutes lasting for 35 seconds. her cervix

is 2 cm dilated and 50% effaced. while the nurse is assessing the client's vital signs, the client says, "i think my bag of water just broke." which intervention would the nurse do first?
Biology
1 answer:
Marina86 [1]3 years ago
8 0
<span>You should check the status of the fetal heart rate.</span>
You might be interested in
Digital waves carry information as a series of zeros and ones, known as binary code. Analog waves carry a continuous range of va
Dmitrij [34]

The answer is B I just took this!!


4 0
3 years ago
Read 2 more answers
Three forms of quackery
mixas84 [53]
Quackery<span> is the promotion of fraudulent or ignorant medical practices. A </span>quack<span> is a "fraudulent or ignorant pretender to medical skill" or</span>"a person who pretends, professionally or publicly, to have skill, knowledge, or qualifications he or she does not possess; a charlatan".
7 0
3 years ago
At what latitude can the noontime sun be observed in the northern part of the sky
kvv77 [185]
60 hope this helps mark as brain lists
4 0
3 years ago
Proteins are
Zolol [24]
I believe its D) transported to other parts of the cell by the endoplasmic reticulum from ribosomes



                                     
8 0
3 years ago
Landfills are advantageous for waste
kaheart [24]

Answer:

The correct option is A.

They have cheaper disposal fees.

8 0
2 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which tissues receive stimuli and conduct impulses or electrical signals in the body?
    8·2 answers
  • What is the name of the process that requires energy (adenosine triphosphate, or atp) for digested nutrients to be absorbed thro
    6·1 answer
  • A student is measuring the effect of different temperatures on the effect of enzymes in biological systems. What temperature ran
    14·1 answer
  • Which statement describes a research finding that demonstrates the functional lateralization of the brain that is involved in la
    13·1 answer
  • Is mucous an enzyme or harmone​
    12·1 answer
  • Pleasee help meee ill mark brainiest!! :) tysm
    8·2 answers
  • Which subshell is represented by the actinides series.
    11·1 answer
  • A cell contains a unique combination of genetic material likely originating from two different individuals. Which type of cell c
    15·2 answers
  • Can you help me 20 points!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!