1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
4 years ago
14

How do convection currents cause the motion of tectonic plates??

Biology
1 answer:
lesantik [10]4 years ago
5 0
Convection currents describe the rising, spread, and sinking of gas, liquid, or molten material caused by the application of heat. ... Tremendous heat and pressure within the earth cause the hot magma to flow in convection currents. These currents cause the movement of the tectonic plates that make up the earth's crust.
You might be interested in
The partial pressure of oxygen in arterial blood is approximately:.
rusak2 [61]

Answer:

between 75 mmHg and 100 mmHg

Explanation:

7 0
3 years ago
Calculate the actual size of the organelle (A to B). Show all your workings in microns (um). <br>​
fredd [130]

To measure the diameter of a organelle with a scale line of 1 µm.

  1. Measure the length of the scale line on the micrograph in mm, e.g. 1 µm = 17mm.
  2. Measure the diameter of the organelle in millimetres, e.g. = 60mm.
  3. True diameter of organelle.

<h3>How do you find the actual size of an organelle?</h3>

To calculate the actual size of a magnified specimen, the equation is simply Mixed6 :

Actual = Image size (with ruler) ÷ Magnification.

Thus, this is how we can measure the size of an organelle.

To learn more about organelle click here:

brainly.com/question/14165698

#SPJ1

3 0
2 years ago
Which observation do most scientists think supports the big bang theory as a description of the origin of the universe?
solong [7]
B. The Universe Expanding
5 0
3 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
4 years ago
Lime obtained from limestone is an important ingredient in the manufacture of cement. Would the Cayuga Lake Basin be a good or p
Kamila [148]

Answer:

Within the geological structure of Cayuga Lake Basin there is a diversity of limestone sources, which would make it possible for the lake to be a good location for the construction of a cement-making plant.

Explanation:

Cayuga Lake, part of the so-called Finger Lakes, located in New York, has an extension of about 40 miles. This lake is of great economic and ecological importance, because it allows fishing and recreation activities, besides being a place of passage for migratory birds.

The Skaneateles, Onandaga, Marcellus, Manilius, Moscow and Tully formations are an important source of limestone of variable quality, from which lime can be obtained for the manufacture of cement.

Although the presence of limestone would be ideal for building a cement-making plant, a project of this size should consider the environmental impact it could have.

Learn more:

brainly.com/question/13764464

4 0
4 years ago
Other questions:
  • Spray drying is a process in which a liquid containing
    10·1 answer
  • Which of the following are the three kinds of RNA? A. rRNA, dRNA, mRNA B. rRNA, mRNA, tRNA C. iRNA, mRNA, sRNA D. tRNA, dRNA, rR
    14·2 answers
  • What type of transformation cannot be used to create an image that is congruent?
    5·1 answer
  • When asked to remember life events, vivid memories from which age range are most likely to be reported?
    9·2 answers
  • What is the best conclusion about the trend in creative careers shown on the graph? The number of people in creative careers has
    5·1 answer
  • What would most likely be impossible in plants without turgor pressure?
    10·2 answers
  • Which of the following correctly describes the disruption of an ecosystem service by an anthropogenic activity?
    11·1 answer
  • What is the attractive pull between any two objects
    6·2 answers
  • The primary function of DNA in cell to
    6·1 answer
  • Can someone help me with this please
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!