1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artist 52 [7]
3 years ago
12

Which statement is an example of parasitism? A. Psuedoscorpions hide under beetles’ wings for protection and transport. B. Wasps

lay eggs inside hornworms and after the eggs hatch, the wasp larvae feed on the hornworm. C. Lions and hyenas live in a savanna ecosystem and eat the same prey, antelopes. D. Otters contribute to a high level of diversity in their ecosystem because they eat urchins, allowing kelp to grow. E. Ladybugs consume insects such as aphids, mealyworms, and spider mites.
Biology
1 answer:
sladkih [1.3K]3 years ago
8 0

Wasps laying eggs inside hornworms and after the eggs hatch, the wasp larvae feed on the hornworm is the example of parasitism.

Explanation:

There are five types of relationships in an ecosystem. One of the relationships is parasitism. When we define ecosystem, we talk about the kind of interaction that there is between two or more different species.

Parasitism is the type of interaction between two species, in which one species, most likely a parasite, latches itself onto the other species. That other species then becomes a host to the parasite. After latching itself, it becomes dependent on it's host for resources like food and shelter. But, in this type of relationship, the host species is harmed for resources while the parasite species gains strength over time.

You might be interested in
5 factors that affect lung capacity
pogonyaev
Age- younger people have smaller capacity
gender-males have larger capacity
muscle mass
aerobic fitness
diseases of the respitorary system
6 0
3 years ago
How does binary fission differ from multiple fission
IRINA_888 [86]

Answer:

Here's a couple of things...

Binary fission results in two daughter cells while multiple fission results in numerous daughter cells

Binary fission occurs under favorable condition while multiple fission occurs under unfavorable condition

Binary fission is where the parental body divides once while multiple fission is where the parental body divides repeatedly

Explanation:

Hope this helps you!

4 0
1 year ago
Read 2 more answers
Plasmids are small circular DNA molecules found in bacteria that replicate separately from chromosomes. Why are plasmids essenti
oksano4ka [1.4K]

Answer:

DNA from a gene of interest can be inserted into a plasmid, then the modified plasmid can be inserted into a bacterial cell to replicate a gene of interest many times.

Explanation:

Plasmids are the extra-chromosomal circular DNA present in bacterial cells. Plasmids are able to replicate themselves independent of genetic DNA. Their ability to self replicate allows them to maintain themselves in the bacterial cells. This is why plasmids are used as cloning vectors in recombinant DNA technology.

A gene of interest is isolated from the donor cell and is inserted into the plasmid. The recombinant plasmid is introduced into bacterial cells where it replicates the ligated desired gene and allows the gene cloning. For example, the human insulin gene is ligated with plasmid and the recombinant plasmid is introduced in <em>E. coli</em> where it replicates the human insulin gene and allows the production of desired copies of the gene.

4 0
2 years ago
⚠️HELP⚠️ QUICK
abruzzese [7]

Answer:

I believe it will be D. all of the above.

Explanation:

4 0
2 years ago
Read 2 more answers
Neurosecretory cells make and release the hormones of the posterior pituitary. The cell bodies of these neurosecretory cells rec
REY [17]

Neurosecretory cells make and release the hormones from the posterior pituitary. The cell bodies of these neurosecretory cells receive synapses from Afferent neuron and their axon terminals release hormones into blood stream or the local extracellular space.

Neurohormone is  generally produced by neurosecretory cells and liberated by nerve impulses. Neurosecretory cells receive synapses from afferent neurons to guide magnocellular neurons .

A synapse is known as a  small junction at the end of a neuron that allows any signal to pass through one neuron to another. Synapse is a junction were the one neuron get connected with the other neuron .

To learn more about neuron , here

brainly.com/question/24217914

#SPJ4

3 0
10 months ago
Other questions:
  • Some cell types contain thousands of mitochondria. These cells are likely to use large amounts of which of the following?
    15·1 answer
  • What is the outside of the virus made of?
    7·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How does tuberculosis(tb) evade the human immune system?
    10·1 answer
  • What is the name for a complex organized group of organisms?
    15·1 answer
  • Select the correct answer,
    12·2 answers
  • The students in Mrs. Cosby's class were observing worms. The students wanted to find out if a worm's body weight is related to h
    13·2 answers
  • The ad populum fallacy occurs when
    15·1 answer
  • How does the mutation present in 10% of Europeans protect their cells from HIV?
    7·2 answers
  • When cells lose their ability to regulate the cell cycle, they can divide an accelerated rate and from a mass of cells. This mas
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!