Answer:
Algal blooms occur when algae multiply very quickly. Blooms can form in waters that are rich in the nutrients the algae need to grow, such as nitrogen, phosphorous, and iron. ... Blooms may become more frequent as the earth warms and the levels of nutrients in our waters increase.
Answer:
Un elemento químico es un tipo de materia constituida por átomos de la misma clase. En su forma más simple, posee un número determinado de protones en su núcleo haciéndolo pertenecer a una categoría única clasificada por su número atómico, aun cuando este pueda desplegar distintas masas atómicas.
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
