Some examples of limiting factors are biotic, like food, and mates. Limiting factors can affect the populations of both plant and animal species. An invasive species is an organism that is not indigenous, or native, to a particular area.
Answer:
The correct answer will be-gas absent in primordial atmosphere (oxygen).
Explanation:
The Miller experiment was performed in 1953 to show that organic molecules can be formed from the inorganic molecules in the conditions resembling the primordial atmosphere.
Same conditions were created to the unstable atmosphere like a mixture of gases which included- methane, sulfur dioxide and hydrogen but lacked oxygen as it was absent in the primordial atmosphere.
Thus, gas absent in the primordial atmosphere (oxygen) is the correct answer.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Indeed, It is a progestin
Answer: Mesopotamia, china, indus River Valley, the mesoamerican empires..... in this case, the two rivers are the tigris and Euphrates. Mesopotamia. The name Mesopotamia was given to the middle eastern civilizations that existed between the Euphrates and Tigris Rivers. :)
