Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
<em>The statement that is incorrect is :</em>
<em>Robert wanted to see if his theory was true that cigarette smoke will influence web-building in spiders.</em>
Explanation:
A theory can be described as a descriptive explanation of a phenomenon which is supported by valid experiments and careful examination of facts. As Robert, has not conducted any experiments nor has proved his study with reference to facts, hence it cannot be considered as a theory.
Robert wanted to see if his observation was true that cigarette smoke will influence web-building in spiders will be the correct statement that could be used.
Food storage and digestion take place inside a food vacuole in the cytoplasm of amoeba.<span> Once digested, it reaches each cell organelle.</span>
Solved ✓
<span />
<em>A transgenic organism is an organism with DNA from another organism.</em>
Being more precise a GMO is an organism whose inherited character has been changed.
A memoir describes the biography that is personally written in which all life events are captured in words with his memory so it is not considered historical document because
<span> a memoir relies largely on the writer's memories
</span>because it rely on writer memory and he can also forget something
so correct option is C
hope it helps
