1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igor_vitrenko [27]
3 years ago
8

What should I do when my family makes fun of me because i have Entomophobia (fear of any insect) everytime i go outside and see

a cicada or ladybug or something like that they said oh stop crying (im crying by just being by them) its just a bug i thought a raised a strong kid (im a girl)
and it makes my anxiety worse and just makes me sad and mad that they have the nerve to say that
Biology
2 answers:
Daniel [21]3 years ago
7 0
Tell them to stop being like that and tell them if they were scared of insects would they like it if you were to make fun of them and tell them you can’t control that fear and this is for you try and learn about the insects such as butterfly’s and lady bugs ect, and you will learn how nice they are also ignore them then they will have no interest in bullying you
Thepotemich [5.8K]3 years ago
7 0

Answer:

It depends on who is making fun of you. If your parents are making fun of you, then they aren't very good parents. If your siblings are making fun of you, it's normal, but tell your parents when they make fun of you or tell them to stop.

Also, being afraid of wasps and spiders is common, but being afraid of a ladybug is a little strange in my opinion.

You might be interested in
Stones caused by the precipitation of minerals, such as calcium, and other substances from the urine or kidney filtrate are ____
Mashcka [7]

Kidney stones are stones caused by the precipitation of minerals, such as calcium, and other substances from the urine or kidney filtrate.

<h3>What are Kidney stones?</h3>

These are hard deposits of minerals such as calcium etc which stick together in the urine of affected individuals.

This thereby causes pain when urine is being expelled from the body as a result of the large size.

Read more about Kidney stones here brainly.com/question/26697997

#SPJ12

8 0
2 years ago
How many bacteria can you have in ten hours if you started with one bacteria?
pav-90 [236]
Bacteria can divide every minute, so given 600 minutes in ten hours it would be an extremely large number

8 0
4 years ago
Which plant can help remove pollutants in rivers and lakes? Water pollutants in rivers and lakes can be removed by .
EleoNora [17]

Answer:

duckweed

Explanation:

a tiny aquatic plant

6 0
3 years ago
Read 2 more answers
HELP!<br> This is hard to do
sweet [91]

Answer:

Model J

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement below is true of both chloroplasts and mitochondria?
MissTica

Answer:

Its either B or D but i think its B

Explanation:

i hope it B if not then its D

7 0
3 years ago
Other questions:
  • Some statistics show that people who are more educated have fewer children. Which of the following could possibly explain this p
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Damage to the ________ nerve would result in near paralysis of the eye.
    14·2 answers
  • Karyotypes can be studied to determine an organism’s chromosomal makeup and to detect genetic defects. Patau syndrome occurs whe
    14·1 answer
  • Which process is part of the carbon cycle?
    5·2 answers
  • In a dense forest, trees compete with one another for space to grow and for sunlight. Although all trees need water, why is wate
    9·1 answer
  • I wanna go do something with my mom.... ideas??
    15·2 answers
  • Two true-breeding stocks of pea plants are crossed. one parent has red, axial flowers and the other has white, terminal flowers;
    9·1 answer
  • Which of the following events can result in offspring with unique heritable characteristics?
    9·2 answers
  • What elements do sugars and amino acids have in common?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!