1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dsp73
3 years ago
5

Beadle and Tatum's concept of the gene has been further refined to state which of the following most correct and current idea?

Biology
1 answer:
Rufina [12.5K]3 years ago
3 0

Answer:

a. one gene - one enzyme

Explanation:

Genes are connected to enzymes was first suggested by Sir Archibald Garrod. Later on, Beadle and Tatum carried out genetic studies on <em>Neurospora </em>and confirmed Garrod's hypothesis.

The link between genes and enzymes was called “one gene-one enzyme hypothesis”.

But this hypothesis is not accurate and changed because some proteins are encoded by genes are not enzymes. Some genes do not encode a whole protein but a subunit of a protein. In general, one polypeptide (a chain of amino acids) encoded by one gene.      

You might be interested in
one of the best-known mechanisms of population control is the parasite/host relationship. true or false?
nadezda [96]
False <span>its predator-prey relationship</span>
6 0
4 years ago
Why is this relationship between a plant and bacteria called a mutualism?
belka [17]
Mutualism is relationship that is beneficial to both organisms involved. The relationship between a plant and a bacterium called a mutualism because both of them help each other. Bacteria are involved in increasing the fertility of the soil by fixing atmospheric nitrogen and thus provide plant with nitrogen. In return, the bacteria make their homes in what usually become nitrogen "nodules" along plant roots. The plant gets food, the bacteria gets shelter, everybody wins.
8 0
3 years ago
Most _____ are crops like corn, goldenrod, or clover.
Kobotan [32]
Most mesophytes are crops like corn, goldenrod, or clover.
7 0
3 years ago
Read 2 more answers
Based on these statements, which of the following to you think are true? Select all that apply:
julsineya [31]
A and C are the answers
3 0
3 years ago
Spirilla are bacteria that can cause _____.
ratelena [41]
C) syphilis

rat bite fever is also caused by this bacteria
5 0
4 years ago
Read 2 more answers
Other questions:
  • What might happen to the sea star population after oyster beds are destroyed
    9·1 answer
  • The nursing is caring for four different clients with eye disorders. Which client should be assessed for asthma before prescribi
    14·1 answer
  • Select the pair of structures that best shows how plant cells are different from animal cells. A. cytoplasm and mitochondria B.
    7·2 answers
  • What happens during the day at the beach? (Apex)
    15·2 answers
  • What would happen if all the hawks in this ecosystem died from an illness?
    5·1 answer
  • What does an enzyme’s structure have to do with a catalytic activity?
    7·1 answer
  • This type of cell is found in females and is needed for reproduction​
    12·2 answers
  • Adenine always pairs with <br> .<br><br> Cytosine always pairs with <br> .
    10·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Identify the structures in the cell
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!