1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saul85 [17]
3 years ago
9

One piece of evidence for the endosymbiotic theory is that the mitochondria and chloroplasts of eukaryotes _____.

Biology
2 answers:
VLD [36.1K]3 years ago
8 0

Answer:

One piece of evidence for the endosymbiotic theory is that the mitochondria and chloroplasts of eukaryotes is all of the above .

liraira [26]3 years ago
5 0
<span>all of the above </span>

Mitochrondria of the eukaryotic cells.
<span>As many researchers hypothesize that the old single-celled organism or the origin of the complex-celled organisms came from the endosymbiosis of the mitochrondrion organism and the prokaryotic cell. It has been said that mitochondria was an independent organism which then to have been evovled itself after planting itself inside a prokaryotic cell which aided cellular respiration and production of ATP (Adenosine Triphosphate). This then aided the prokaryotic cell to be more sophisticated and caused another change from having without a true nucleus to a eukaryotic cell with a nucleus and embedded DNA. <span>
</span></span>

You might be interested in
I need help with c &amp; d please !!
maw [93]
C. It happens over a period of time not overnight
d.<span>29,035 feet mount eversest</span>
5 0
3 years ago
Why would it be hard to find the CO2 level if the light intensity were very low? HELP!!!!
drek231 [11]
If CO2 was in very small amounts then it would be the limiting factor of photosynthesis, this means the process will take place at a much slower rate because it is lacking one of the raw materials it needs for the process to occur. To find the optimum light intensity you really need all other factors to be at optimum levels or in abundance.
4 0
4 years ago
The first step in the catabolism of amino acids is the removal of the nitrogen as ammonia, forming a keto acid that can enter on
ANTONII [103]
The coenzyme required is pyridoxal phosphate. It is a vitamins B6 cofactor required for transamination reaction.
5 0
3 years ago
Why are interactions between biotic factors necessary
qaws [65]

Answer:  because the interactions between these organisms enable the cyclic flow of energy and nutrients in the ecosystem.

Explanation:

6 0
3 years ago
Which terms correctly identify the indicated structures in this
hammer [34]
I hope this picture helps you

8 0
3 years ago
Other questions:
  • What is ATP? List the three components of an ATP molecule. What is ATP used for?
    13·1 answer
  • Sugar also travels in the blood stream to all parts of the body. Does sugar travel into the body cells in the same way? Why or w
    9·1 answer
  • What were three patterns of diversity that Darwin noticed during voyage
    11·1 answer
  • Loess is sediment made up of fine particles of silt that have been deposited far from their source by ____________________.
    11·2 answers
  • Are lipids made of nucleotides
    13·1 answer
  • Which of the following is not an accurate description of chemical reactions?
    13·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Angelique has several symptoms of pneumonia that her doctor diagnoses as being caused by a virus. Her parents ask for an antibio
    5·2 answers
  • A "mystery molecule" was isolated in a laboratory and scientists found that the molecule readily crossed artificial membranes. W
    10·1 answer
  • Contrast potential and kinetic energy. Give an example of potential being changed to kinetic energy.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!