1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet [91]
3 years ago
9

I need help with c & d please !!

Biology
1 answer:
maw [93]3 years ago
5 0
C. It happens over a period of time not overnight
d.<span>29,035 feet mount eversest</span>
You might be interested in
Thinking about taxonomy, the basic unit of naming, that includes
strojnjashka [21]

Answer:

species.

Explanation:

Taxonomy can be defined as the process of naming, classification and description of living organisms such as plants and animals. Thus, it is the biological classification of living organisms based on similarities or characteristics such as eyes, number of legs, etc.,

The eight (8) biological classification (taxonomy) used for grouping and organizing organisms are; kingdom, domain, phylum, family, order, class, genus and species.

In taxonomy, species refers to the basic unit of naming that includes members such as mammals and reptiles with the ability to reproduce with each other to birth new offsprings and exchange genetic informations. Some examples of species include Homosapiens, Vulpes, Elephas maximus, Pinus banksiana, Alces laces, Ursus americans, Canis lupus, etc.

In conclusion, taxonomy helps scientist to have good understanding and knowledge when studying various organisms.

3 0
3 years ago
How have marine sediments helped scientists learn about ancient climates?
Alexxandr [17]
The species of plankton found in sediments and their isotope ratios can show the temperature of the overlying waters when the sediments were deposited.
7 0
3 years ago
Read 2 more answers
Which electrolyte permits the interaction of actin and myosin, thereby causing muscle contraction?
sergejj [24]
Calcium. Just giving it to you straight :)

8 0
3 years ago
Quien creó la crema anti estrías
blsea [12.9K]
Yo no lo see por que no quedó lol (^з^)-☆
5 0
3 years ago
What type of bond do water molecules form with eachother​
Marianna [84]

Answer:

In the case of water, hydrogen bonds form between neighboring hydrogen and oxygen atoms of adjacent water molecules. The attraction between individual water molecules creates a bond known as a hydrogen bond.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • In all patients, what locations should be checked for skin color?
    5·1 answer
  • How can a change in technology affect scientific knowledge?
    8·1 answer
  • A copper coin is placed so it touches a brass coin. The temperature of the copper coin is 100 degrees celsius. The temperature o
    14·1 answer
  • Can someone please write a 250-word essay about one of these systems
    8·1 answer
  • Which is considered to be a scientific theory? A) how gravity works B) the fact that gravity exists C) the fact that gravity is
    11·2 answers
  • At what point in the development of the embryo do you think a pregnant woman must begin to increase the number of calories she c
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Helps organisms transport nutrients.<br> a.<br> soil<br> b. sap<br> C. water<br> d wind
    7·2 answers
  • The rapid leaf movements resulting from a response to touch (thigmotropism) primarily involve _____.
    14·1 answer
  • Explain why the deletion or inactivation of the SH3 domain in Src would have an oncogenic effect while the mutation of Tyr 416 t
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!