<em><u>It</u></em><em><u> </u></em><em><u>is</u></em><em><u> </u></em><em><u>good</u></em><em><u> </u></em><em><u>to</u></em><em><u> </u></em><em><u>vaccinate</u></em><em><u> </u></em><em><u>people</u></em><em><u> </u></em>
<em><u>but</u></em><em><u> </u></em><em><u>after</u></em><em><u> </u></em><em><u>the</u></em><em><u> </u></em><em><u>vaccination</u></em><em><u> </u></em><em><u>this</u></em><em><u> </u></em><em><u>is</u></em><em><u> </u></em><em><u>too</u></em><em><u> </u></em><em><u>,</u></em><em><u> </u></em><em><u>important</u></em><em><u> </u></em><em><u>to</u></em><em><u> </u></em><em><u>boast</u></em><em><u> </u></em><em><u>their</u></em><em><u> </u></em><em><u>immunity</u></em><em><u>.</u></em><em><u>.</u></em>
Explanation:
<em>Because</em><em> </em><em>of</em><em> </em><em> </em><em>build</em><em> </em><em>their</em><em> </em><em>immunity</em><em> </em>
<em>it</em><em> </em><em>can</em><em> </em><em>help</em><em> </em><em>to</em><em> </em><em>fight</em><em> </em><em>with</em><em> </em><em>other</em><em> </em><em>diseases</em><em>.</em><em>.</em><em>.</em><em>.</em>
<em>hope</em><em> </em><em>it helps you</em><em>:</em><em>)</em>
The answer for this question is D.Mechanical weathering of very fing grained blue grey clays
Hope i helped please brainliest answer if possible
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
1 and 3
Explanation:
If you look at it the same things they have are
Phylum - Chlordata
Class - Mammalim
Order - Carnirvora
Family - Felidae
Genus - Felis
(sorry if i spelt something wrong, i cant really read it that well)
Sustainability refers to how a system remains biodiverse and productive over long periods of time. Succession is a series of predictable changes that occur in a community over time. After a fire, volcano, or other disaster, succession enables an ecosystem to recover.
