1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedbober [7]
4 years ago
9

The central opening in the eye through which light passes is the

Biology
1 answer:
Snowcat [4.5K]4 years ago
7 0

Answer:

More information please

Explanation:

You might be interested in
What is the meaning of selective premeable
Flura [38]

Answer:

Selective permeability is a property of cellular membranes that only allows certain molecules to enter or exit the cell. ... Movement across a selectively permeable membrane can occur actively or passively. For example, water molecules can move passively through small pores on the membrane.

Explanation:

8 0
3 years ago
A forensic scientist is trying to find out the number of adenine in the DNA sample that he obtained from a crime scene.
Schach [20]
The forensic scientist can assume that the number of adenine is always equal to the number of thymine, according to the base pair rule. Adenine matches with the other purine pair, thymine because it is the only thing to which it could have a hydrogen bond with. 
6 0
3 years ago
Read 2 more answers
If we assume that each square in the Punnet square represents one offspring of the heterozygous AaBbCc parents, then the square
V125BC [204]

Answer:

A. The phenotypes that result from having 2 or 4 dark-skin alleles

Explanation:

8 0
3 years ago
Target organs regulate the pituitary through feedback loops. Most often, this takes the form of
kenny6666 [7]

Answer:

negative feedback inhibition.

6 0
2 years ago
Please help I dont understand and it will be nice for someone to help!!!!!!!!!!!!!!!!!
andre [41]
It is b density ! Good luck sorry if late
3 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Identify the four postulates of natural selection.A challenge to traditional (pre-1860) ideas about species came from embryology
    8·1 answer
  • The trees in a forest all have closed stomata. what is the cause?
    14·1 answer
  • Is a gene that can be masked by dominant gene
    11·2 answers
  • If you found a vertebrate skull in the woods and the teeth were sharp and scissor-like, what type of food would you expect this
    10·1 answer
  • Which is the result of using one or more of your senses to gather information
    15·2 answers
  • A woman who is in the first trimester of her pregnancy has told the nurse, "I've stopped taking my blood pressure pill because I
    8·1 answer
  • All organisms need a place to live that provides? I
    6·1 answer
  • 1. ¿Crees que hay algún elemento de tu cuerpo que no cambie durante toda tu vida? O, todo cambia
    14·1 answer
  • Which statement about human blood vessels is correct?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!