1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
13

How is cancer related to cell division

Biology
2 answers:
Rom4ik [11]3 years ago
5 0

Answer:cell division is how cancer spread in the body

Explanation: Cancer cells are mutated and overtake good cells

nikdorinn [45]3 years ago
3 0
Cancer is the rapid, uncontrollable division of cells.
You might be interested in
(( YOU HAVE TO CHOOSE 3 )) <br> [[ can anybody help me with this question? I'd appreciate it (: }}
Ivanshal [37]
Industry agriculture and medicine
8 0
3 years ago
Read 2 more answers
Which would most likely cause the liquid in Tube A to rise?
lara [203]

Answer:

d solute in the tubes changing

Explanation:

4 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
The ________ in keratinocytes protects the epidermis and dermis from the harmful effects of sunlight.
Vikentia [17]
Melanin conveys some UV protection
4 0
3 years ago
Scientists discovered fossils in several layers of the Earth you see here. They found fossils of algae, snails, and clams in lay
Maurinko [17]
They found the fossil evidence in a place where there was once a body of water such as the ocean.
6 0
4 years ago
Read 2 more answers
Other questions:
  • Explain how a paleontologist might use absolute dating techniques to determine the age of a fossil.
    14·2 answers
  • At which boundary does subduction stop occurring, resulting in a mountain range?
    5·2 answers
  • Rust results from iron’s reaction to oxygen. An iron nail gains mass when it rusts. How does this reaction support the law of co
    8·2 answers
  • Two well-understood sncrnas in eukaryotic cells are:
    5·1 answer
  • Research will be done over the Circulatory System also known as the Cardiovascular System.
    7·1 answer
  • Angelman Syndrome or Prader Willi will be present in a child when:
    14·1 answer
  • What is a thermocline?
    7·1 answer
  • What type of bonds are found between the 5-Carbon sugar of one nucleotide and the Phosphate group of the next?
    6·1 answer
  • A T G A A A T A C ⟶ A C T G A A A T A C
    10·1 answer
  • Bio
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!