Aorta!
Hope this helps! :)
Binary Fission i believe is the answer have a very nice day
Answer: Temperature control
Explanation:
Arterio-venous anastomoses (AVAs) are direct connections between small arteries and small veins. In humans they are numerous in the glabrous skin of the hands and feet.
They are very significant in body temperature control. These temperature control are under the dual control of the central nervous system and the local thermal influence. While the arteriovenous anastomoses control the skin temperature through volume changes in the superficial venous bed, the arterioles and capillaries operate by generalized dilatation which results both in increased temperature and in redness of the skin.
Why do melting ice caps make Earth warmer?
The correct answer is C. Albedo decreases.
When the albedo is lower, more radiation from the Sun gets absorbed by the planet resulting in rise of temperature. When the snow covered area warms up and melts, the albedo goes down and more sunlight is absorbed in that area and the temperatures increase.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
