1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jonny [76]
3 years ago
15

Which of the following is stored within the nucleus of the cell and acts as a code book for synthesizing specific proteins?

Biology
1 answer:
Damm [24]3 years ago
8 0
The answer to this question would be D (DNA). It can be found in the nucleus of a cell and contains the entire genetic information of a whole.
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
This might be easy but i dont know​
grin007 [14]
Cellular respiration.
8 0
2 years ago
What is a cellular organelle? list 5 different organelles that a cell might possess, and indicate the function of each. also, sp
timurjin [86]
A cellular organelle is a structure in the cell that performs a specific function.

Nucleus - stores cell's DNA; DNA replication occurs here

Ribosome - produce protein; "factories" of the cell

Mitochondria - breaks down food for energy to be used by the cell; "powerhouse" of the cell

Vacuole - store materials such as food, water, sugar, minerals, and waste products

Endoplasmic reticulum - carry materials throughout the cell; "transport system"
6 0
3 years ago
Compared to the time he spent in other parts of South America, Darwin spent little time collecting specimens in the Galapagos.
Feliz [49]

The correct answer is True

7 0
3 years ago
Read 2 more answers
What is the creative development of science to solove problems or to make tasks easier called
zubka84 [21]

Answer:

i think its a computer because copmuter is a multiy task machine that can solve our many problem

Explanation:

there alot of discoveries of science thst can solve our problem

7 0
3 years ago
Other questions:
  • Which of the following structures is considered to be the fundamental building block of the nervous system?
    13·2 answers
  • In the Indian painting featuring the Mughal Emperor Babur in his garden ( 1.8.9), the garden is punctuated by a specific feature
    9·1 answer
  • What biomolecule is part of the structure of ATP, nucleotides, and nucleic acids?
    7·1 answer
  • Rh blood factor is determined by:
    7·1 answer
  • An individual's 23 chromosome pairs make up his or her:
    15·2 answers
  • what is your opinion on the balance of nature? should we get involved if a species is slowly disappearing?
    10·1 answer
  • Number of Differences Pair of Species 2 Porpoise and S. Whale 3 Deer and Giraffe 3 Porpoise and Rt. Whale 3 Hippo and Porpoise 3
    6·1 answer
  • Traditional chemotherapy drugs target cell processes that then halts cell division or results in cell death. Thus, these drugs a
    7·1 answer
  • Materials that allow the charges of an electric current to move freely through them are called a. Insulators. B. Conductors. C.
    15·1 answer
  • true or false. sugars and phosphates break off from the dna nucleotide to provide energy for dna replication.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!