1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
2 years ago
9

During an action potential, repolarization occurs as a result of

Biology
1 answer:
Vedmedyk [2.9K]2 years ago
4 0
As a result, the membrane permeability to sodium declines to resting levels.
I hope this helped:)
You might be interested in
Enzymes in your gastrointestinal tract digest your lunch. these chemical reactions are categorized as:________
BigorU [14]

Enzymes in your gastrointestinal tract digest your lunch. these chemical reactions are categorized as catabolism.

<h3>What is catabolism?</h3>

The series of metabolic processes known as catabolism reduces molecules into smaller pieces that are then either oxidized to produce energy or utilised in other anabolic processes. Large compounds are divided into smaller components through catabolism.

<h3>What is a prime illustration of catabolism?</h3>

Catabolism happens as you are breaking down food. For instance, a piece of bread is broken down into simple components your body may absorb, such glucose, through this process (blood sugar).

<h3>What is difference between catabolism and anabolism?</h3>

The series of metabolic processes known as catabolism reduces molecules into smaller pieces that are then either oxidized to produce energy or utilised in other anabolic processes. The process of anabolism produces the molecules the body needs to function. Energy is released during the catabolism process. Energy is needed for anabolic processes.

To learn more about catabolism visit:

brainly.com/question/13021229

#SPJ4

5 0
2 years ago
A man with type A blood marries a woman with type B. Their offspring all have type AB blood. The pattern of inheritance is calle
Shkiper50 [21]
The answer is: a) codominance
8 0
3 years ago
Read 2 more answers
What are 5 major results of global climate change ​
Sindrei [870]

Answer:

Change Will Continue Through This Century and Beyond

Global climate is projected to continue to change over this century and beyond. The magnitude of climate change beyond the next few decades depends primarily on the amount of heat-trapping gases emitted globally, and how sensitive the Earth’s climate is to those emissions.

Temperatures Will Continue to Rise

Because human-induced warming is superimposed on a naturally varying climate, the temperature rise has not been, and will not be, uniform or smooth across the country or over time.

Frost-free Season (and Growing Season) will Lengthen

The length of the frost-free season (and the corresponding growing season) has been increasing nationally since the 1980s, with the largest increases occurring in the western United States, affecting ecosystems and agriculture. Across the United States, the growing season is projected to continue to lengthen.

In a future in which heat-trapping gas emissions continue to grow, increases of a month or more in the lengths of the frost-free and growing seasons are projected across most of the U.S. by the end of the century, with slightly smaller increases in the northern Great Plains. The largest increases in the frost-free season (more than eight weeks) are projected for the western U.S., particularly in high elevation and coastal areas. The increases will be considerably smaller if heat-trapping gas emissions are reduced.

Changes in Precipitation Patterns

Average U.S. precipitation has increased since 1900, but some areas have had increases greater than the national average, and some areas have had decreases. More winter and spring precipitation is projected for the northern United States, and less for the Southwest, over this century.

Projections of future climate over the U.S. suggest that the recent trend towards increased heavy precipitation events will continue. This trend is projected to occur even in regions where total precipitation is expected to decrease, such as the Southwest.

More Droughts and Heat Waves

Droughts in the Southwest and heat waves (periods of abnormally hot weather lasting days to weeks) everywhere are projected to become more intense, and cold waves less intense everywhere.

Summer temperatures are projected to continue rising, and a reduction of soil moisture, which exacerbates heat waves, is projected for much of the western and central U.S. in summer. By the end of this century, what have been once-in-20-year extreme heat days (one-day events) are projected to occur every two or three years over most of the nation.

Hurricanes Will Become Stronger and More Intense

The intensity, frequency and duration of North Atlantic hurricanes, as well as the frequency of the strongest (Category 4 and 5) hurricanes, have all increased since the early 1980s. The relative contributions of human and natural causes to these increases are still uncertain. Hurricane-associated storm intensity and rainfall rates are projected to increase as the climate continues to warm.

3 0
3 years ago
Read 2 more answers
Which is a factual statement that cannot be changed or replaced?
LekaFEV [45]
Observation is a factual statement that cannot be changed or replaced.

Explanation)

Hypothesis is a tentative statement that can be tested.
Scientific law and theory are considered a fact but can be disproven if new evidence emerges.
6 0
3 years ago
Which class of macromolecules is primarily used as rapidly available energy sources by living thing?
Dmitry_Shevchenko [17]

Answer:

The correct answer is - carbohydrates.

Explanation:

The four significant groups of macromolecules found in living beings are carbohydrates, lipids, nucleic acids, and proteins. carbohydrates comprised of carbon, hydrogen, and oxygen molecules, generally in a proportion of 1 : 2 : 1.

Living things use carbohydrates as their main form of energy.  Carbohydrates are a class of macromolecules is essentially utilized as a quickly accessible energy source by living things.

Thus, the correct answer is - carbohydrates.

7 0
3 years ago
Other questions:
  • Consider the model of natural selection. In order for the end result to be dark gray circles, what do you know about the populat
    8·2 answers
  • How are human activities disturbing carbon dioxide levels and affecting marine life ?
    14·1 answer
  • What is the donut shaped gland that surrounds the urethra?
    7·1 answer
  • Mature human sperm and eggs are similar in that
    6·1 answer
  • What component of the circulatory system is at tissue level
    10·2 answers
  • How has a rise on global temperature impacted the life of the polar bear? A rise in temperatures has disrupted the Arctic food c
    12·1 answer
  • Which statement describes how geologists use data from seismographs to learn about earthquakes?
    14·2 answers
  • Sedimentary rocks are commonly made of ____ that are compacted and cemented together
    10·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • How many bones are there in donkey​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!