1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Yanka [14]
3 years ago
12

I need a hypothesis for this question, I'm trying to understand this and what to write down: In the study of salamanders the res

earcher decided to further investigate the effect water quality had on the salamanders survival. State a hypothesis that may be used in such a study.
Biology
1 answer:
9966 [12]3 years ago
7 0
I think that the worse the quality of the water is the more negative effects it is going to have on the salamanders and the better the quality of the water is the more positive effects it is going to have on the salamanders because the in other study’s the more polluted a body of water was the more defects animals had that used that body of water
You might be interested in
The outermost layer of the earth.the layer of the earth were earthquakes occur
Korolek [52]
The outermost layer of the Earth is called the crust.
8 0
3 years ago
Explica la siguiente oración: “muchas de las adaptaciones que vemos en los organismos
Aleksandr-060686 [28]

Answer: Explain the following sentence: “many of the adaptations that we see in organisms

Explanation: i took spanish

5 0
3 years ago
What is the name of the group of proteins that can speed up the process or reduce the activation energy of a reaction? a) enzyme
Lilit [14]

Answer:

The answer is a) enzymes

8 0
3 years ago
Read 2 more answers
Schizophrenia is partially caused by an overabundance of dopamine signaling in the brain. Thus, to treat schizophrenia, doctors
cestrela7 [59]

Answer:

Antagonist

Explanation:

Dopamine antagonists are a type of drugs that the block the dopamine receptors. They are usually used to treat bipolar, schizophrenia, and more.

Have a lovely rest of your day/night, and good luck with your assignments! ♡

8 0
2 years ago
Human impact on ecosystems would most likely lead to secondary succession over primary succession.
masya89 [10]
The Statement would be true stated by the definition
5 0
2 years ago
Read 2 more answers
Other questions:
  • Who is the founder of Cognitive problem Solving View of dream analysis
    10·1 answer
  • Data Collection: Pinky’s science fair project in junior high focused on an observation that the crickets outside her window chir
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • (05.02 LC)<br> Which of the following is one stage of the cell cycle?
    5·1 answer
  • should the government of nations ban or control DNA/Gene Editing on human beings and/or human embryos?
    13·1 answer
  • Select from the drop-down menu to correctly complete the statement.
    8·1 answer
  • 6. Which generations saw a population altering incident? Use your imagination to invent a
    7·1 answer
  • I NEED HELP QUICK! I will give brainliest
    6·1 answer
  • The data in the graph are the result of a paramecium being placed in a hypertonic salt solution.
    5·1 answer
  • Can someone help me please​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!