1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
4 years ago
12

The transmission of genetic material from one generation to the next is necessary for the survival of a species. Which statement

describes one property that helps to ensure the reliable transmission of genetic information in living organisms?
Question 4 options:

A)

RNA uses a nucleotide base called uracil to distinguish itself from DNA.

B)

A pyrimidine base will only pair with the correct purine base.

C)

The two strands of a DNA molecule cannot be separated.

D)

Translation of mRNA to assemble a protein is a reversible process.
Biology
1 answer:
krek1111 [17]4 years ago
5 0
A is the correct answer
You might be interested in
Q: Why does using a parachute make it possible for sky divers to jump safely out of an airplane?
morpeh [17]
C
........................
7 0
3 years ago
Read 2 more answers
How can we recognize non-renewable resources and work to preserve them as long as possible?​
Lerok [7]
A non-renewable resource is a natural resource that cannot be readily replaced by natural means at a quick enough pace to keep up with consumption. One way to preserve them as long as possible is to decrease the use of them or use renewable resources instead.
8 0
3 years ago
The Endosymbiotic Theory was proposed by Lynn Margulis in the 1970s.
Anestetic [448]
The endosymbiont theory explains the origin of the eukaryotic cell organelles where the cells were engulfed but not digested by the larger prokaryotic cells and in the process developed into the chloroplast, mitochondria and other organelles.
(A) The theory was trying to explain the evolutionary origin of the various cell organelles and,
also explains the dependence of cells on one another.
(B) The evidences that supported the Endosymbiotic theory includes;
    -The photosynthetic bacteria; This bacteria utilize the sun's energy to make energy hence the oxygen released from the process accumulated in the atmosphere thereby leading to the death of the anaerobic cells.
    -Organelles have their own DNA and divide independently, therefore Margulis predicted that if the organelles were really prokaryotic symbionts, then they would have their own DNA.
    - The study of fossils showed the aerobic cells in it, therefore the cells  could use the toxic oxygen and convert it into ATP(energy) and water. Organisms that could thrive in aerobic environments were now best suited to the environment.
6 0
3 years ago
Simulate a 24-hour day (12 hours of light, 12 hours of dark). How many snails
Igoryamba
The hours of daylight and dark time depends on where you are but how many snails and plants it takes to keep a stable environment my guess would be a few thousand snails and a couple thousand plants and also they have to be different kind of plants of so they can benefit from each other all around.
3 0
3 years ago
Which of the following is not a component of soil?
OlgaM077 [116]

Answer:

D. None of the above

Explanation:

all the answer choices are found in soil

5 0
3 years ago
Other questions:
  • Which of the following attributes are true regarding fungi? They can form close symbiotic relationships with plants that are req
    14·1 answer
  • 9. All the organisms in a forest will__________with one another.<br><br>​
    7·2 answers
  • Eutrophication results in the death of trout and other fish as a result of
    13·2 answers
  • Given the distribution of the 30 or so animal phyla across the Earth's various ecosystems, what would be the most likely habitat
    5·1 answer
  • DNA samples should be stored in an airtight containers to prevent contamination true or false
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How do facts differ from theories?
    5·1 answer
  • What are the dark areas on the surface of the sun
    10·2 answers
  • Precipitation in a deciduous forest can be in the form of rain or snow. Please select the best answer from the choices provided
    14·2 answers
  • An acid is best defined as: Select one:
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!