Answer: To do different kinds of jobs
Explanation:
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
they have the same genetic code the first ones
Explanation:
Answer:
Bubbles are a sign that the yeast is alive, and that it is performing anaerobic respiration. You should notice that the mixtures with too little and too much sugar do not grow, bubble or foam properly. This is because the yeast needs the perfect amount in order to produce carbon dioxide.
Explanation:
Benefits of living on land: Sunlight is brighter, since it doesn't have to go through water first. More carbon dioxide in the atmosphere than in the ocean. Mineral nutrients are plentiful in the soil.
