1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lapo4ka [179]
3 years ago
9

Which consequence of global warming is described as having an increase in growing season, changes in migration, and loss of spec

ies?
A.changing oceans
B.melting ice
C.affected human populations
D.altered ecosystems
Biology
2 answers:
Anestetic [448]3 years ago
8 0
"Altered ecosystems" is the one consequence of global warming among the following choices given in the question that <span>is described as having an increase in growing season, changes in migration, and loss of species. The correct option among all the options that are given in the question is option "D".</span>
DaniilM [7]3 years ago
5 0

The correct answer is (d) altered ecosystem.

The increase in the global temperature all over the world due to the harmful effect of green house gases is called global warming. The consequences of global warming can be defined as having an increase in growing seasons, changes in migration and loss of species. All the consequences mentioned here signifies altered ecosystem. The ecosystem consists of the plant and animal species that interact with the environment. Hence, global warming results in altered ecosystem.

You might be interested in
Which of these is an environmental effect of burning fossil fuels?
KIM [24]
The correct answer is a
5 0
3 years ago
Read 2 more answers
The male reproductive parts of a flower are called
gulaghasi [49]
The correct answer in this question is letter B. The male reproductive parts of a flower are called stamens. It is composed of an anther and a filament. The pollen, which is located in the anther, contains the male reproductive cells.
7 0
3 years ago
Which item listed below would complete this food chain?
Whitepunk [10]
A. Tree leaves

Explain: because giraffes are herbivores their diet mainly consists of leaves and plants.
6 0
3 years ago
Which could increase the amount of greenhouse gases in
bogdanovich [222]

Answer:

C. Burning coal to produce electricity

5 0
3 years ago
Read 2 more answers
Remember that the glomerulus is the initial filtering sieve of the nephron.
Mars2501 [29]
Filtration rate = 125 mL/minute = 0.125 L/min
Minutes in a day = 24 hours x 60 minutes per hour
Minutes in a day = 1440 
Total filtrate per day = 0.125 x 1440 = 180 L

Number of 2 L bottles to be filled = 180 / 2
= 90 bottles

This value is very large and we do not produce this much urine in a day. This means a portion of the fluid is being reabsorbed.

Absorption.
<span />
8 0
3 years ago
Other questions:
  • Why is the trachea constructed with rings of cartilage
    10·1 answer
  • What’s the original cell in meiosis
    8·2 answers
  • There are several reasons why the skeletal system is unique. here are a few of the reasons:
    15·1 answer
  • Which situation could cause an ecosystem to lose its equilibrium
    13·2 answers
  • The bacteria found in soil is usually harmful and measures are taken to remove any traces of microorganisms.
    14·1 answer
  • Use Punnett square to predict the outcomes for the following crosses:
    15·2 answers
  • Which sentence best describes vestigial structures? They contain genetic mutations. They may have had an important function in t
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • If you stab a cereal box does that mean your a cereal killer
    6·1 answer
  • explain why gene expression is regulated, considering the advantages of regulating enzyme activity versus transcriptional contro
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!