1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
3 years ago
14

3. Summarize why the definition of species had changed over time

Biology
1 answer:
Tasya [4]3 years ago
3 0

Answer:

Originally, the distinction was based on morphological differences. However, it soon became that some types of organisms had different forms at various stages in their lives, here is why

Explanation:

changed genes is passed on to the next generation. Most mutations are bad, but some of them make the organism more successful in its life. Organisms that inherit that favorable new gene are likely to become more abundant than others of the species. (geologic times)

You might be interested in
Over time weeds have become resistant to pesticides. Which process explains how pesticide resistance developed? A. natural selec
Mice21 [21]
A. Natural Selection.  This is because the weeds that are not resistant to it die out before they can reproduce, but the resistant ones grow to maturity and then reproduce, passing down the resistance gene.  Over time, the resistance gene would become a normal thing in weeds, while the non-resistant gene would not exist anyone, since the gene could not be passed on.
6 0
3 years ago
some plant seeds live through cold winters but do not sprout until spring. in winter these seeds are ________
Gwar [14]

the answer is dormant

7 0
3 years ago
Help please <br> Can u define it on your own words please <br><br> THANK YOU
tresset_1 [31]
<span>Allergy-
A medical condition that causes someone to become sick after eating, touching, or breathing something.

Allergen
A substance or object that causes allergies.

Hope this helps!!

</span>
6 0
3 years ago
One student claims that yogurt is made by lactic acid fermentation. Another claimer claims that yogurt is made by alcoholic ferm
Lerok [7]
It is (D) Carbon dioxide.
in lactic acid=C6H12O6 to produce 2C3H6O3+Energy.
in alcoholic fermentation=C6H12O6 to produce 2C2H5OH+2CO2.
therefore all of them produce (D) Carbon dioxide.
7 0
4 years ago
Read 2 more answers
Organism in which the embryonic blastopore becomes its anus
Anika [276]

Organism in which the embryonic blastopore becomes its anus Deuterostome

<u>Explanation:</u>

The term Deuterostome refers to second mouth. The first opening which is called blastpore becomes its anus in deuterostomes. In protostomes, this first opening will be the mouth.  The other name given to these Deuterostomes enterocoelomates. It is the enterocoely from which the   coelom of  Deuterostom starts emerging and growing.  

Chordata, Echinodermata, Hemichordata are the classes of deuterostomes:. The zygote is the one that gets developed first in  protostomes and deuterostomes.Radial cleavage occurs in deuterostom in which the division of cells lies either in parallel direction or in perpendicular direction with respect to the polar axis.

3 0
3 years ago
Other questions:
  • according to the theory of evolution, birds feathers evolved from: a) reptiles scales b) fish fins c) gill slits d) gill arches
    9·1 answer
  • Why do you think the size of a white dwarf affects its visual luminosity?
    9·1 answer
  • Members of this arthropod group have three body parts...
    12·1 answer
  • Why would water stop soaking into the ground in the saturated zone?
    15·1 answer
  • 1. A(n) _____ shows you the schedule of payments on a loan and the total
    7·2 answers
  • What do all scientific investigations begin with?
    8·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What unique features do the cells along the digestive tract have
    6·1 answer
  • How does the role of nucleic acids compare to the other biomolecules?
    9·1 answer
  • for this question, unless they are clearly affected with the disease (like individual ii-5), assume that the disease allele is r
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!