Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
The correct answer is ''the mechanisms for coordinating subunits.''
Explanation:
Integration mechanisms are explicitly defined to coordinate subunits. In turn, are divided into structural and non-structural mechanisms. Structural integration mechanisms coordinate activities and are usually linked to specific management positions or bodies. The non-structural integration mechanisms, for their part, are characterized because they do not create organs or positions, but they constitute a relevant complement to the structural mechanisms, facilitating the organization of work. Informal integration mechanisms or those aimed at facilitating informal relationships are the simplest and easiest to use. Individuals face a certain situation and, spontaneously, communicate with each other. If no further coordination is required, informal mechanisms may be sufficient
Answer:
Gravity.
Explanation:
Gravity is what causes stuff to fall. It also keeps us on the ground, If there were no gravity, life wouldn’t exist as we know it today. Brainliest please! I need brainlest in order to keep answering questions!!
I would say b! The sunlight is absorbed by the thylakoids (inside the chloroplast) which is part of the process of photosynthesis