1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
3 years ago
5

The absorption spectrum for carotenoids are shown here. These are accessory pigments associated with photosynthesis, but they ar

e not the main pigments that drive photosynthesis. If plants reabsorb their chlorophyll pigments, leaving only carotenoids in the leaf, what color would the leaves appear?
A) blue
B) green
C) orange
D) purple
Biology
2 answers:
s2008m [1.1K]3 years ago
8 0

Answer:

Orange

Explanation:

Kobotan [32]3 years ago
3 0

Answer:

The correct answer is orange.

Explanation:

Carotenoids are the accessory pigments generated by plants.Carotenoid belongs to terpinoid family of secondary metabolites.Many vegetables such as pumpkin,tomato, carrot have specific color combination only due to the presence of carotenoids.

      Carotenoid is responsible for orange,yellow and red coloration of various vegetables such as pumpkin,carrot,tomato etc.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Dinitrophenol increases the permeability of the lipid bilayer of the inner mitochondrial membrane to protons. Assuming that all
Zigmanuir [339]

Answer:

The correct answer is : C .It will decrease ATP production because fewer protons will be able flow down through ATP synthase.

Explanation:

  • Oxidative Phosphorylation is a process which involves two steps:  
  1. Transport of electrons from the reduced compounds like NADH (Nicotinamide adenine dinucleotide hydrogen) and FADH₂ (Flavin adenine dinucleotide dihydrogen) through the electron transport complexes, located in the inner mitochondrial membrane, to oxygen for the generation of water molecules.
  2. Synthesis of ATP or adenosine triphosphate from ADP or adenosine diphosphate and inorganic phosphate by an enzyme called ATP synthase which is located in the inner mitochondrial membrane. This enzyme harnesses energy by carrying protons from the inter-membrane space into the mitochondrial matrix and in the process produces ATP.
  • Oxidative phosphorylation takes place in the mitochondria, especially involving the inter membrane space, inner membrane and mitochondrial matrix
  • During the transport of electrons through the protein complexes (I, II, III, IV) of the electron transport chain a proton gradient is generated across the inner mitochondrial membrane.
  • The proton gradient is such that the concentration of protons is more in the inter-membrane space and less in the matrix of the mitochondria.
  • This proton gradient provides the energy to the ATP synthase for the synthesis of ATP.
  • Dinitrophenol is responsible for making the inner mitochondrial membrane permeable to protons. As a result protons can directly diffuse through the inner mitochondrial membrane from the inter-membrane space into the mitochondrial matrix equalising the concentration of protons across the inner mitochondrial membrane. This causes distortion in the proton gradient.  Hence, protons are no longer available for the ATP synthase to operate and synthesise ATP.
4 0
3 years ago
Explain why the white-tailed deer population is considered a nonnative species in New Zealand
noname [10]

Answer:

They were introduced by humans

Explanation:

I attached a PDF document, just take a part of it that seems to work the best, and put it through a paraphrasing tool so it doesn't get flagged for plagiarism

Download pdf
7 0
3 years ago
Please complete the numbers on the flowchart using words.
guapka [62]

Answer:

1=producers (plants)

2=carnivores

3=omnovores

4 0
2 years ago
HELP ASAP PLS! no links :)
marissa [1.9K]

Answer:

c.

Explanation:

Energy is transferred between the Earth's surface and the atmosphere in a variety of ways, including radiation, conduction, and convection.

6 0
3 years ago
Other questions:
  • Which of the following is true for identical twins?
    8·1 answer
  • True or false: anything the ER makes is sent off in a Vesicle.
    12·1 answer
  • "producers and consumers rely on ____________ to release chemical energy stored as atp."
    12·1 answer
  • Drag each tile to the correct location.
    7·1 answer
  • Ultrasound involves high-frequency sound waves. Sound waves can be used to image internal structures. This is the basis of tomog
    15·2 answers
  • When a wave reaches a beach or coastline, it releases a burst of energy that generates a current, which runs parallel to the sho
    7·1 answer
  • Por qué se dice: ""Lo que le sucede a un individuo tiene su origen en una célula""
    6·1 answer
  • What structural adaptation of the A. cristatus lizard helps them on land?
    13·2 answers
  • Which of these is an example of an abiotic factor
    6·1 answer
  • Which adaptations allowed reptiles to complete their life cycles on land? an amniotic egg lungs four legs ectothermic metabolism
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!