1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gavmur [86]
3 years ago
5

How long should i workout to lose weight?

Biology
1 answer:
Kazeer [188]3 years ago
7 0
It's depend of your weight and you tall.
Also it's depend if you are doing sport or a diet.
You might be interested in
How could you calculate the speed of a snail or cheetah?
yKpoI14uk [10]

Answer:

you could calculate the speed of a snail or a cheetah by measuring a distance and measuring the time it takes them to get there. direction would be considered if you were finding velocity.

Explanation:

5 0
3 years ago
Plants maintain higher levels of phytochrome at their growing tips where phytochrome plays important roles in growth responses t
Naddika [18.5K]

Explanation:

Phytochrome is a protein with kinase activity present in plant organisms, whose function is to act as a photoreceptor mainly of red light (600-700nm) and distant red light (700-800nm), thanks to its chromophore. The phytochrome depending on the type of light detected can trigger different responses in the plant, such as flowering, germination, growth as an escape response to the shadow -development of epicotyls at night and cotyledons during the day-, regulation of expression of metabolic activity during day and night (circadian rhythms).

Phytochromes were discovered in the fifties as part of an investigation on the effect of light on the germination of lettuce seeds. It was observed that the seeds that germinated in the dark did not reach 20%; On the contrary, the germination percentage was maximum when the seeds were irradiated with a pulse of red light (R). It was also found that subsequent irradiation with a pulse of distant red light (RL) nullified the inducing effect of red light, preventing germination.

Alternating irradiation with light R and RL (R, R + RL, R + RL + R, R + RL + R + RL, etc.) showed that the last color applied determined the germination of the seeds and that the light red was the stimulating factor of the process and, its inhibitor, the distant red light.

In search of an explanation of such phenomena, the existence of a pigment was proposed, which they called phytochrome, which absorbed the red light. The phytochrome in question, after absorbing red light, became a way capable of absorbing distant red radiation; form that turned to its initial condition after performing said absorption. The hypothesis found experimental support in the early sixties with the purification, from extracts of cereal seedlings, of a protein endowed with the predicted characteristics. Phytochromes are soluble proteins found in the seeds, leaves, stems, roots and other organs of the plant.

Biochemically, phytochrome is a protein with a Bilin chromophore.

6 0
3 years ago
Why are disifectants alone not enough to kill an entire population of bacteria
matrenka [14]
Your answer
More-resistant endospores of themophilic bacteria may survive, but wont germinate and grow under normal storage.
7 0
3 years ago
Which of the following is a cost of mining aluminum from new bauxite
Veronika [31]

Answer:

Threatening rain forest organisms

Explanation:

8 0
3 years ago
Read 2 more answers
When you increase your velocity on a skateboard, it is harder to stop. Which is this an example of?
Leviafan [203]
Friction if you try and stop

h





3 0
3 years ago
Other questions:
  • How can u identify a prokaryotic cell
    13·1 answer
  • What function do chloroplasts perform?
    10·2 answers
  • The harmless scarlet kingsnake has scales in a coloration and pattern resembling the scales of the dangerous coral snake. The sc
    11·2 answers
  • What is the function of a sperm
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Differentiate between sub-cellular and acellular particles with examples
    8·1 answer
  • The goal of sequencing all human DNA base pairs and identifying all human genes belongs to
    15·1 answer
  • I WILL GIVE BRAINLIEST!!
    9·1 answer
  • Item 3
    8·2 answers
  • some monkey flowers (mimulus guttatus) living near the sites of copper mines can grow in soil containing high concentrations of
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!