1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sindrei [870]
3 years ago
5

People hope that _____ will be the long-term solution to the world's energy proplem

Biology
1 answer:
yan [13]3 years ago
6 0
I believe that renewable energy may be the answer because D is absolutely not the answer and A would not help us. That's leaves us with B and C and B seems like it's a better choice than C.
You might be interested in
Match each graph with its correlation coefficient.<br> +1.0<br> +0.85<br> +0.15<br> -0.50<br> -1.0
Elan Coil [88]

Answer:

-0.50

Explanation:

For the graph displayed, the most probable value of the correlation Coefficient is - 0.50 ; the line of best fit has a negative skoe and hence will have a negative relationship as the correlation Coefficient is a statistical value which measures the degree of relationship between two variables. Also, the distribution of data in the plot does not give a perfect fit, hence a correlation Coefficient of - 1.0 isn't possible for the distribution shown.

8 0
2 years ago
Would areas along the shores of the Great Lakes have warmer summers and colder winters than other inland areas? Why or why not?
Klio2033 [76]

Answer:  Because the Great Lakes act as a heat source during the winter, coastal air temperatures are more moderate than the air temperature in inland areas. Winter: There is less radiation from the sun, generally making temperatures cooler. That means the lakes are warmer than the air.

Explanation:

4 0
3 years ago
The product of photosynthesis is what
bonufazy [111]

Answer: The main product of photosynthesis is glucose,

Explanation:

7 0
3 years ago
Read 2 more answers
What are the symptoms of failure for hyperopia?
meriva

Answer:

Blurry Vision.

Difficulty Concentrating.

Eye Strain.

Fatigue.

Headaches.

Squinting to See Better.

Explanation:

8 0
3 years ago
Read 2 more answers
Which brand of popcorn leaves the fewest unpopped kernels?
e-lub [12.9K]
The Jolly Time popcorn, I believe.
5 0
3 years ago
Other questions:
  • How does a salmon increase the chances of the survival of its own species
    12·2 answers
  • The mohs scale measures a mineral’s _____. a. luster b. structure c. density d. hardness
    14·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which of these sentences describes a benefit of fracking? A. Fracking provides jobs for people at well sites in the United State
    9·2 answers
  • Mitochondria have their own DNA. What might that mean about their origin in our cells?
    10·2 answers
  • WILL GIVE THANKS AND BRAINLIEST ANSWER!!!!!!
    7·1 answer
  • Energy of activation a. is the energy required for molecules to react with each other. b. requires the use of enzymes. allows fo
    8·2 answers
  • 2. If you cannot see most cells with just your eyes, how can you see a unicellular organism?
    9·1 answer
  • A disturbance that transmits energy through a medium is a(n)
    11·1 answer
  • What difference in axonal signaling determines whether we experience a mild or a strong sensation?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!