1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Margarita [4]
3 years ago
14

A model of DNA replication in which the parental DNA molecule is maintained and the daughter DNA molecule contains two newly syn

thesized strands of DNA is called ____________ replication. Please choose the correct answer from the following choices, and then select the submit answer button.
Biology
1 answer:
Leviafan [203]3 years ago
8 0

Answer:

Semi-Conservative

Explanation:

After DNA replication, the parental DNA molecule contains two original DNA strands while the daughter molecule is composed of two newly synthesized strands. In this model, the two DNA strands in the parental molecule separate from each other and serve as templates for the synthesis of daughter strands.

You might be interested in
The process of filtration in the kidney is most accurately described as
Vedmedyk [2.9K]
It is described as relatively non specific 
8 0
3 years ago
What is the significance of environmental factors to the health of individuals and to public health
Temka [501]

Answer:No

Explanation:

because tables dont have lampshades

3 0
3 years ago
All of the following statements about diploid cells are true except: *
Gemiola [76]

they contain half of a set of chromosome...that's jot true

3 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
WILL PICK BRAINLIEST!!
Lady_Fox [76]
I think C would be correct
7 0
3 years ago
Other questions:
  • The marine iguanas are the only marine lizard in the world and they live in the (2 points)
    14·1 answer
  • Darwin’s theory of evolution offers a scientific explanation for which of the following ?
    13·2 answers
  • Prokaryotes reproduce by ___________, which creates _____ exact daughter cell clone(s) of the original parent cell.
    5·1 answer
  • Why is genetic engineering so important in the first place?
    7·1 answer
  • 5. A(n) ______, such as a salamander, is an organism that gains body heat primarily by absorbing it from the environment.
    8·1 answer
  • A recovery heart rate for a person who is 25 years of age after 5 minutes of working out is about:
    6·2 answers
  • A recessive allele __________.
    6·1 answer
  • Explain various part of a leaf with well diagram​
    7·1 answer
  • How do planaria regenerate?
    6·1 answer
  • With your group members discuss and answer the following questions.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!