1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
UNO [17]
3 years ago
11

"In order to have reached this conclusion, the Grants must have either assumed or proven that several other facts about the finc

h population were true. Which statements represent information that must be true in order for the Grants conclusion to be correct

Biology
1 answer:
photoshop1234 [79]3 years ago
8 0

Note:

Question is incomplete I have added the full question at the end of this answer.

Answer:

All these below statements are in parallel with the research publication published in 2006 about darwin's work. Furthermore, Darwin proved that beak evolution occurred at Galapagos island.

Correct Options are

1. Beak size varies among the birds in the finch population under study.

2. Birds that could eat larger, tougher seeds survived and reproduced during the drought.

3. Beak size is an inherited trait in the finch population under study.

Reference:

Grant, Peter R., and B. Rosemary Grant. "Evolution of character displacement in Darwin's finches." science 313.5784 (2006): 224-226.

FULL QUESTION

"Population thinking" is essential to the idea of natural selection. Rather than thinking of populations or species as sets of mostly identical individuals, Darwin and Wallace understood that a great deal of heritable variation occurs among individuals within populations. Which example best illustrates this idea?

"Population thinking" is essential to the idea of natural selection. Rather than thinking of populations or species as sets of mostly identical individuals, Darwin and Wallace understood that a great deal of heritable variation occurs among individuals within populations. Which example best illustrates this idea?

Giraffes have longer necks than zebras.

You have a different eye color than your classmate.

Soybeans have a higher protein content than corn.

You have a different haircut than your classmate.

You have a different eye color than your classmate.

How did the drought lead to an increase in beak size in the medium ground finch population? The Grants reasoned that

prior to the drought, the finch population fed primarily on small seeds that they could open easily. Although larger, tougher seeds were available, they were not typically eaten, not even by finches with larger beaks.

during the drought, only a limited number of small seeds were produced, leaving mostly larger, tougher seeds available for food. Finches that were unable to eat the larger seeds died of starvation.

Based on their observations and the data they collected, the Grants concluded that evolution by natural selection had occurred in the medium ground finch population. The increase in the average beak size of the offspring was a direct result of the change in the food supply during the drought.

In order to have reached this conclusion, the Grants must have either assumed or proven that several other facts about the finch population were true. Which statements represent information that must be true in order for the Grants conclusion to be correct?

Select the three statements that must be true.

Select the three statements that must be true.

An individual finch's beak size can change depending on the size of the seeds it eats.

Beak size varies among the birds in the finch population under study.

Birds that could eat larger, tougher seeds survived and reproduced during the drought.

Beak size is an inherited trait in the finch population under study.

The drought caused a mutation that led to larger beak sizes in the finch population.

You might be interested in
Diferencia entre las bacterias y los virus.
myrzilka [38]

Answer:

Los virus son más pequeños y no son células. A diferencia de las bacterias, necesitan un huésped como un humano o un animal para multiplicarse.

Las bacterias son organismos vivos unicelulares. Tienen una pared celular y todos los componentes necesarios para sobrevivir y reproducirse. Los virus no se consideran "vivos" porque requieren una célula huésped para sobrevivir a largo plazo, para obtener energía y para reproducirse.

Explanation:

6 0
3 years ago
Read 2 more answers
Any three ways by which harmful subtances could contaiminate bod
saul85 [17]
Through a cut or an injury where any skin has been broken.

An infection through an animal's bite or sting.(Like the West Nile Virus which spreads though mosquito bite, or Rabies though an infected mammal's bite).

Can be inhaled or consumed and go from the lungs into the other organs causing harm internally.
  

4 0
3 years ago
MRNA<br> UGU UAU AUC GAA
Lapatulllka [165]

Answer:

I can not see the picture?

6 0
3 years ago
What is at least one reason why science cannot help to answer ethical or moral social issues?
Varvara68 [4.7K]
Because what we do comes down to our own conscious and moral values. Also everyone responds to situations differently
7 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • Eurokraytic cell cycle what stage is labeled c in the diagram
    12·1 answer
  • A nurse is delivering 3 l/min oxygen to a patient via nasal cannula. what percentage of delivered oxygen is the patient receivin
    10·1 answer
  • A scoop of ice cream is placed on top of a warm piece of pie in a bowl.
    6·2 answers
  • The process of making rna from dna
    13·1 answer
  • Question 8 of 20:
    13·1 answer
  • Name three elements used to date fossils with absolute dating
    14·1 answer
  • Some traits are inherited and some are acquired. Which of the following is mostly an acquired trait?
    10·2 answers
  • A flashlight uses four batteries to power it. Which type of current flows inside the flashlight? A. direct B. alternating C. rep
    9·2 answers
  • _________and_______ factors can affect an organism’s traits.
    14·2 answers
  • Which is the most likely cause of tropical storms
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!