1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
15

Which of the following was determined by Charles Darwin, but based on contributions from another scientist?

Biology
1 answer:
valkas [14]3 years ago
7 0

Answer:

Species could go extinct when their environment changed if they could not adapt to the change.

You might be interested in
The type of organism that can transfer the energy of sunlight to sugars and ATP is called an
maria [59]

The answer to you question autotroph

I hope it helps you

4 0
3 years ago
The geometric shape of crystals indicate that:
Shkiper50 [21]
The answer is option C
3 0
2 years ago
Read 2 more answers
Onsidering that gluconeogenesis requires a net input of 4 atp equivalents compared to glycolysis, why would a cell utilize this
Pani-rosa [81]

The process by which organisms create sugars (specifically glucose) from non-carbohydrate precursors is known as gluconeogenesis.

  • The only energy source used by the brain, testes, erythrocytes, and renal medulla is glucose, with the exception of ketone bodies during fasting. There are three highly exergonic stages in glycolysis. Hexokinase, phosphofructokinase, and pyruvate kinase are among the enzymes involved in these additional regulatory stages. In biological processes, both forward and backward reactions are possible.
  • Similar to glycolysis, but with the process going the other way, is gluconeogenesis. Fructose-1,6-bP, glucose-6-P, and pyruvate all undergo fairly spontaneous conversions in the process of gluconeogenesis, which is why these reactions are tightly controlled.
  • For the organism to function properly, energy conservation is crucial. Gluconeogenesis is suppressed when there is an abundance of energy available.

Therefore, gluconeogenesis conserve more energy.

Learn more about gluconeogenesis:

brainly.com/question/1425339

#SPJ4

6 0
1 year ago
Where can the following organelle be found: Mitochondria. Also if it a multiple choice.
xxMikexx [17]

Answer:

all of them

Explanation:

Mitochondria are found in the cells of nearly every eukaryotic organism, including plants and animals. Cells that require a lot of energy, such as muscle cells, can contain hundreds or thousands of mitochondria.

BUT EACH CELL HAS A DEFINING TRAIT ABOUT THEM

-PROKARYOTIC-no nucleus

-PLANTS- cell wall. large central vacuole

-ANIMALS-multicellular might have more than one mitochondria

3 0
3 years ago
The lock and key mechanism refers to
LUCKY_DIMON [66]
The mechanism of enzymatic action within a single substance
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following shows all of the tripeptides that can be formed from one molecule each of lysine (Lys), threonine (Thr),
    10·2 answers
  • A hypothesis is a possible explanation that can be tested by observation or experiment
    14·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • In order to move molecules in your kidneys or in your blood your body needs
    8·2 answers
  • What are the symptoms of being allergic to sugar in children?
    6·1 answer
  • What are the layers of your skin called?
    9·2 answers
  • 58. Which reaction occurs in chloroplasts? -
    5·1 answer
  • Seeds (dominant) and wrinkled seeds (recessive)
    8·1 answer
  • Please help answer these 3! 50 points
    7·2 answers
  • Help me please and thank you ​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!