1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
8

Primary functions of the medusa?

Biology
2 answers:
Mazyrski [523]3 years ago
7 0

Answer:

The primary function of medusa is to carry out sexual reproduction and to allow the species to disperse to different locations.

Explanation:

There are two distinct cnidarian body forms: polypoid and medusoid.

The medusa is more of an umbrella or bell shape, with the mouth facing down. The body of the medusa is often called the bell. Medusae are usually free-swimming and either propel themselves using muscle contractions or float along water currents like plankton.

aalyn [17]3 years ago
3 0

Answer:

turn people into stone

Explanation:

You might be interested in
landscape management attracts people to nature preserves and national parks what are the benefits to the wildlife in these areas
Ket [755]

Answer:

one benefits to wildlife in national and nature parks are, that there are is not hunting within the parks. not only does this protect the wildlife, it also sustains the balance of life. nature and wildlife parks allow a careful eye to be placed on the animals that are going extinct or are even victims of severe hunting. this allows this generation as well as their future offspring to be healthy and ensure safety. a benefit to the public would be the, scenic routes you can walk on a trail, besides walking and being outdoors, any contribution/ donations are ensured to go towards rehabilitation of the animals.

Explanation:

i made it up and it gave me 100%

3 0
3 years ago
Read 2 more answers
Addison has decided to learn transcendental meditation (tm). she will be given training in _____.​​
Ksivusya [100]

Answer: how to use a repeated sound to focus her attention

An individual like Addison will be given training on how to use a repeated sound to focus her attention. Transcendental meditation allows the mind and body to settle into a quiet state of restful alertness. This will give Addison feeling refreshed, energized, and at peace.

8 0
3 years ago
Read 2 more answers
Put the following stages in order: G2,G1, S, mitosis, cytokinesis.
Oliga [24]
G1, S, G2, Mitosis, Cytokinesis

Just did this yesterday lol hope it helps


3 0
3 years ago
Read 2 more answers
What is Cross-pollination.​
aliya0001 [1]

Answer:

This is the pollination of a flower with pollen from another flower.

Explanation:

This is under the type of pollination.

Hope it helps.

6 0
3 years ago
Read 2 more answers
perhaps you have heard that the greenhouse effect can cause a problem if too much heat is trapped. Extra heat is trapped because
Korvikt [17]

Answer:

In the process of photosynthesis, trees tend to take up carbon dioxide and water and convert it into oxygen and glucose. In this way, trees help in reducing the amount of carbon dioxide from the air which is otherwise a source of global warming. The process of photosynthesis also yields oxygen which is beneficial for life on earth.

The trees also store carbon inside them hence, reducing global warming. The more the trees, the more will be the chances of carbon being reduced from the atmosphere and being stored in the trees.

Plant processes like transpiration help to lower the temperature around them. Hence, more the trees, lesser will be the rise in temperature.

7 0
3 years ago
Other questions:
  • Which figure is closest to the age of the solar system?
    14·1 answer
  • Employees who frequently have a negative attitude can still maintain a high level of productivity.
    11·2 answers
  • What is Atlcin’s diet and how does it work?
    14·1 answer
  • Which of the following is nicknamed the “powerhouse “ of the cell ?
    7·1 answer
  • Gene flow and genetic drift both affect allele frequencies in a population. A high level of gene flow into a population genetic
    12·2 answers
  • The law of explains how alleles separate during gamete formation.
    5·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Ash trees are being removed when they show signs of the ash borer, a parasite that affects the trees and kills them off. What be
    6·1 answer
  • What effects do you think this change in the speed of the ocean currents cold have on living things in the ocean
    14·1 answer
  • SOMEONE PLEASE HELP ME WITH THESE TWO QUESTIONS IM TAKING A QUIZ
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!