<span>The daughter producing sperm used to fertilize Brittany's eggs should be haploid sperm cells. These cells contain one set of chromosomes. The work haploid also refers to the amount of chromosomes in sperm or an egg cell, sometimes called gametes. In human beings, gametes are generally haploid cells that have 23 chromosomes which each has one chromosome pair that can be found in diplod cells.</span>
Considering the definition of density, you obtain that:
- Part A: the density of gold is 19.3 g/cm³.
- Part B: the density of iron is 7.8 g/cm³.
<h3>Definition of density</h3>
Density is defined as the property that allows to measure the amount of mass in a certain volume of a substance.
The expression for the calculation of density is the quotient between the mass of a body and the volume it occupies:
density= mass÷ volume
It can be deduced that density is inversely proportional to volume: the smaller the volume occupied by a given mass, the higher the density.
<h3>Density in this case</h3>
In this case, you know that:
- A sample of gold has mass of 38.6 grams and a volume of 2 cm³.
- A sample of iron has a mass of 46.8 grams and a volume of 6 cm³.
Replacing in the definition of density:
- Gold: density= 38.6 g÷ 2 cm³
- Iron: density= 46.8 g÷ 6 cm³
Solving:
- <u><em>Gold: density= 19.3 g/cm³</em></u>
- <u><em>Iron: density= 7.8 g/cm³</em></u>
In summary, the density of gold is 19.3 g/cm³ and the density of iron is 7.8 g/cm³.
Learn more about density:
brainly.com/question/952755
brainly.com/question/1462554
#SPJ1
Limestone is a sedimentary rock composed primarily of calcium carbonate (CaCO3) in the form of the mineral calcite. It most commonly forms in clear, warm, shallow marine waters. It is usually an organic sedimentary rock that forms from the accumulation of shell, coral, algal, and fecal debris.
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
The answer is true, Sponges can regenerate the entire organism from just a conglomeration of their cells. They can be cut up or mashed, and as long as they have two special cells called collencytes, which produce the gelatinous matrix in the sponge, and archeocytes, which produce all the other cells in the spongeâ??s body, the sponge will reform into the sponge it once was. Although, it will look different. Hope it helps!
