1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
2 years ago
14

How did Sonu parents earn their living ?

Biology
1 answer:
Crazy boy [7]2 years ago
6 0

Answer:

My dear

you should tell about the book the so that anyone can tell you the answer

You might be interested in
Which of the following pairs of structures share the function of rewarding water into the body
IgorLugansk [536]
The structures that are in the body are In a complex environment, animals learn from their responses to stimuli and events. Appropriate response to reward and punishment can promote survival, reproduction and increase evolutionary fitness.
8 0
3 years ago
Read 2 more answers
Collection of glands that secrete hormones into the blood which regulate growth, development, and homeostasis.
Kobotan [32]
The answer is the endocrine system.

The brainest answer would be apprenticed.
6 0
3 years ago
Which act prompted the developers to install stormwater management systems to handle the movement of polluted water?
Gre4nikov [31]
Natural landscapes such as forests, the soil absorbs much of the stormwater and plants help hold stormwater close to where it falls. In developed environments, unmanaged stormwater can create two major issues: one related to the volume and timing of runoff water (flooding) and the other related to potential contaminants that the water is carrying (water pollution).
6 0
2 years ago
Read 2 more answers
Which muscle group name and function is correctly matched? select one:
motikmotik
Fixator (--) helps hold a bone in place
8 0
3 years ago
An object, such as a pair of scissors, can become a temporary magnet by rubbing the object with the end of a magnet.
Alla [95]
In my opinion it is true
7 0
3 years ago
Other questions:
  • What is the function of the nucleolus
    10·2 answers
  • One of the first scientists of the renaissance to advance taxonomy through first hand observations was who?
    14·1 answer
  • "A person who is infected with the bacteria MM294 is instructed by a doctor to take the antibiotic used in this experiment for t
    11·1 answer
  • The plasma membrane has a double layer of phospholipids with _____ dispersed throughout. A. carbon B. phosphorus C. fats D. prot
    13·2 answers
  • At fertilization, what happens to the sex cells
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • In the small intestine, where are fatty acids and monoglycerides absorbed?
    8·1 answer
  • What is the impact of life skill to you? A. To be able to create problems B. To be self assertive. C. To be influenced by friend
    15·1 answer
  • let us suppose a person who has a 45 kg mass is riding along a frictionless roller coaster track. The cart at a particular insta
    15·1 answer
  • Ribosomes are the site where— are produced.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!