1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill115 [55]
3 years ago
14

Why is it important for people to study environmental science.

Biology
2 answers:
Vinvika [58]3 years ago
6 0

Environmental science is the study of interactions among the physical, chemical and biological components of the environment. Environmental science enlightens us on how to conserve our environment in the face of increasing human population growth and anthropogenic activities that degrade natural resources and ecosystems.

ikadub [295]3 years ago
5 0
It’s important because it’s where we live share resources with other species.
You might be interested in
What are some benefits of genetically engi-<br> neered crops?
Stella [2.4K]

Answer:

More nutritious food.

Tastier food.

Disease- and drought-resistant plants that require fewer environmental resources (such as water and fertilizer)

Less use of pesticides.

Increased supply of food with reduced cost and longer shelf life.

Faster growing plants and animals.

Explanation:

Please give me brainliest

5 0
3 years ago
Read 2 more answers
Plzzz help its a big grade
Vlada [557]
C, doubling the mass, as the bigger the object, the more energy is stored. Would appreciate brainliest!
5 0
3 years ago
How much do you think your behavior is influenced by hormones and chemicals in the nervous system?
Soloha48 [4]
This is the answer check it out

6 0
3 years ago
Which process CANNOT occur without carbon dioxide
mart [117]

Answer:

photosynthesis

Explanation:

:)

4 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • What is the main difference between oogenesis and spermatogenesis in terms of meiosis?
    14·1 answer
  • Help. Earth &amp; space science B
    5·1 answer
  • What process involves proteins in vesicles being held at the plasma membrane until the cell is signaled to release them?
    12·1 answer
  • Which part of the human body is most similar to stomata in plants?
    10·1 answer
  • Write out the acronym<br>for DRY MIX below:<br><br><br><br>I NEED HELP​
    6·1 answer
  • _________ are the food factories of the plants .​
    10·1 answer
  • Explain how scientists know what stars are made of.​
    10·1 answer
  • What happens to the DNA molecule at the beginning of transcription?
    8·2 answers
  • In genetic complementation testing, crosses are performed between pure-breeding strains for recessive mutations that confer the
    7·1 answer
  • Which type of stress causes rocks to fold?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!