1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
trasher [3.6K]
4 years ago
14

Xavier has been using a workout app to track his progress at the gym. Lately, he has found that his average heart rate during ae

robic workouts is 129. His lowest target heart rate is 137. Which of the following will help him get the most productive workout, based on the information he has gathered?
Do anaerobic workouts only
Do fewer aerobic workouts
Increase the intensity of cardiovascular workouts
Decrease the intensity of cardiovascular workouts
Biology
1 answer:
kipiarov [429]4 years ago
8 0
The third option: Increase the intensity of cardiovascular workouts, is the right one. we know this because the rest of the options don't give the right fit. anaerobic workout is a short burst of energy, so it wouldn't be a good fit. Doing fewer aerobic workouts would lower it even more. Decreasing intensity of a cardiovascular workout would also cause a larger decrease. so it is the third option. Hope this helps a lot.
You might be interested in
If the thyroid gland is unable to produce iodinated thyroglobulin, what is the effect on hormone production?
Lady bird [3.3K]

Less triiodothyronine (T3) and thyroxine (T4) hormones are made. ... The follicle cells of the thyroid gland produce thyroid hormones while the parafollicular cells produce parathyroid hormone (PTH)

7 0
4 years ago
The ureter, blood vessels, and nerves penetrate the kidney on its medial surface? True or false?
malfutka [58]
True I study this last semester
7 0
3 years ago
What is the smallest LIVING part of an organism?<br><br> A. Molecules<br><br> B. Cells
Savatey [412]

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

6 0
3 years ago
Read 2 more answers
If the greenhouse effect were to completely disappear, what would happen to earth?
dexar [7]

The greenhouse effect is necessary to explain why weather occurs. The climate of the Earth is greatly affected by two opposing processes: the greenhouse effect and atmospheric convection. The greenhouse effect is acting to warm the lower atmosphere and cool the upper atmosphere while the atmospheric convention (composed of thermals, clouds, precipitation) is cooling the lower atmosphere and warms the upper atmosphere). <span>The greenhouse effect warms the Earth’s surface, but very few people are aware that weather processes greatly limit that warming.<span> In the absence of greenhouse effect, the Earth will be left without weather.</span></span>

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • How do bacterial cells maintain their shape?
    6·1 answer
  • Limited resources contribute to evolutionary change in animals by increasing
    7·1 answer
  • Which statement is NOT true of mitochondria?
    14·1 answer
  • Starch is a _____. A.Monosaccharide<br> B. Disaccharide<br> C. hormone<br> D.Polysaccharide
    7·1 answer
  • Nina studies an artificial heart model. The model has tubes that supply an electric current to the model. Nina switches on the c
    12·1 answer
  • #7 can you guys help me
    10·1 answer
  • Would you expect the plants and animals present in the southeast of the U.S. To be similar or different to that of the plants an
    8·1 answer
  • Which of the following statements is true as the moon goes from new moon to full moon
    9·1 answer
  • Which of the following is needed to start the Kreb<br> Cycle?
    11·1 answer
  • 4. In gel electrophoresis, are the dna fragments attracted to, or repelled from the negative pole of the electric field?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!