1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aneli [31]
3 years ago
9

The primary function of DNA polymerase is to:

Biology
1 answer:
Debora [2.8K]3 years ago
3 0

Answer: Option A

The primary function of DNA polymerase is to add nucleotides to the growing daughter strands.

Explanation:

DNA polymerase is an enzyme that synthesis DNA and its main function is to make DNA from nucleotides which is the building block of DNA. It is essential for DNA replication and work in pairs by creating identical DNA strands from the original DNA molecule. DNA copies are created by pairing the nucleotides to each bases present in the DNA molecule.The bases are thymine, cytostine,guanine, and adenine, the pairing occur with any of the above combinations forming two pairs respectively.

You might be interested in
Can someone help me on this .
Ber [7]

Answer:

7) a. Absorbed: black surfaces absorb light, like in a playground.

b. Transmitted: when light falls on transparent objects, it is transmitted, goes straight through the object, like the clear glass of a window

c. Reflected: when light falls on a smooth, shiny object, it bounces off in one particular direction, like looking at the smooth surface of a lake

8 0
3 years ago
There's a good evidence that a meteor hit earth about 65 million years ago which of the following events that the scientist thin
Aloiza [94]

Is this a true or false question?

5 0
3 years ago
If a blue eyed mother with a normal vision has a brown eyed color blind son and a blue eyed colored blind daughter what are the
Rina8888 [55]

Answer: mother: XX^aa, father: X^YAa, son: X^YAa, daughter: X^X^aa.

Explanation:

Color blindness is a genetic disorder that affects the ability to distinguish colors. It is hereditary and is transmitted by an X-linked recessive allele. If a male inherits an X chromosome with the altered allele he will be color blind. In contrast, females, who have two X chromosomes, will only be colorblind if both of their X chromosomes have the altered allele. This is because <u>males have one X chromosome and one Y chromosome, while females have two X chromosomes</u>.  

If the woman has normal vision, that means she cannot have both chromosomes affected. She can only have one affected chromosome (be a carrier) or none at all. Also, if she has blue eyes, which is a recessive trait, then both alleles are recessive. But the eye color is not on the X chromosome. For example, her eye color genotype can only be aa, because if she had at least one dominant allele she would have brown eye color. As for the other trait, she can be XX^, with X^ being an affected (carrier) allele or XX, i.e. both normal. So in summary, her genotype can be XXaa or XX^aa  

If she has a brown-eyed male child who is also colour blind, he has inherited the allele for colour blindness from his mother, since the father does not pass on an X chromosome to the male children, only the Y. With this we can now rule out the mother's XXaa genotype since she had to have passed on her affected X^ chromosome. Then the genotype of the mother is XX^aa. And since her mother can only pass on one allele to (recessive) because she does not have allele A, the dominant that determines her brown eye color can only come from the father. So the genotype of this son is X^YAa. The female daughter has color blindness and blue eyes. So she had to inherit the affected X^ chromosome from the mother (which we already know she has) and an affected X^ chromosome from the father, because the daughter needs to inherit both affected X^ chromosomes to develop the disease. And if she also has blue eyes, she had to have inherited a recessive allele from the mother and another from the father. So with this information we can say that the father's genotype can only be X^YAa. Because the father must have both A and A alleles of the same eye color, because he passed the dominant one to the son and the recessive one to the daughter. At last, the genotype of the daughter is X^X^aa.

8 0
3 years ago
II. Write TRUE if the statement is correct and FALSE if not.
Softa [21]

Answer:

11. i don't know

12.false. Asexually

13.false. no flower

14.false. stems

7 0
3 years ago
Please help some one
Mashutka [201]
2) The adult human body is made up of 206 bones
3) Theirs bones of the skull, spine, ribs, arms, and legs, these are located all through your body.
4) Bones are hard tough organs that forms part of the vertebral skeleton, meanwhile cartilage is a soft flexible tissue that is used to keep your bones from rubbing against one another.
3 0
3 years ago
Other questions:
  • What are the three major groups of protists
    6·2 answers
  • If a lab experiment is not complete, you should​
    15·1 answer
  • Why are plants that are exposed to light more colorful?
    12·2 answers
  • What is the kingdom of fungi
    5·2 answers
  • What are the three parts of an ATP moleclue
    9·1 answer
  • which is not a form of light found on the electromagnetic spectrum? a) X-ray, b) gamma rays, c) am radio waves, d) alpha radiati
    13·2 answers
  • Food web stability is most dependent on _____.
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 2. One of the physical characteristics is that a gas can
    5·1 answer
  • Which process converts carbon in the form of sugar into carbon dioxide gas?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!