1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s344n2d4d5 [400]
3 years ago
9

!!!!!!!

Biology
2 answers:
stiv31 [10]3 years ago
6 0

Answer:

B

Explanation:

Mitosis allows for cells to produce identical copies of themselves, which means the genetic material is duplicated from parent to daughter cells.

Anna [14]3 years ago
5 0

Answer:

A.The DNA in the parent cell nucleus makes a copy of itself and is then split between the two daughter cells during meiosis.

Explanation:

You might be interested in
According to the evolutionary theory of aging, why hasn't natural selection eliminated many harmful conditions and nonadaptive c
Korolek [52]
Evolutionary Theory of Aging describes t<span>he view that natural selection has not eliminated many harmful conditions and nonadaptive characteristics in older adults. N</span>atural selection is linked to reproductive fitness, which is present only in the earlier part of adulthood. According to evolutionary theory, possibly if some disease occurred earlier in development, it might have been eliminated many centuries ago.
8 0
3 years ago
Can birds urinates?​
Crank
Yes they can urinate :)
3 0
2 years ago
Read 2 more answers
5.
inn [45]
I think it would be A
4 0
2 years ago
Read 2 more answers
The plasma membrane functions in each of the following EXCEPT
valentina_108 [34]

C. Synthesis of enzymes for the cell

8 0
2 years ago
Select the appropriate word(s) to complete the sentence.
kicyunya [14]

Seedless plants genetically alternate between generations.

<h3>What is the reproduction cycle of seedless plants like?</h3>

All seedless vascular plants have very similar life cycles. As in bryophytes, their life cycle has two alternating generations:

  • the gametophyte
  • and the sporophyte.
  • The sporophyte is always the dominant and free-living generation.

With this information, we can conclude that seedless plants genetically alternate between generations.

Learn more about Seedless plants in brainly.com/question/10715162

#SPJ1

8 0
2 years ago
Other questions:
  • Before testing for starch, the leaf is warmed in ethanol. The ethanol turns green. Why is this?
    5·1 answer
  • What do you call that missing part of the rock record?
    5·1 answer
  • What does anatomy mean?
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which of the following bacterial cells would best be able to survive an attack by an antibiotic
    8·1 answer
  • Does the first generation offspring have the mothers phenotype or the fathers phenotype
    14·1 answer
  • If an individual homozygous dominant for widow's peak has a child with an individual heterozygous for widow's peak, what is the
    9·1 answer
  • 1. Which of the following best explains how Earth’s atmosphere protects life on the planet?
    15·1 answer
  • Is it hazard or risk
    12·1 answer
  • . A student builds a plant cell model by arranging different foods in a bowl.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!