1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
8

So option 1, 2 or 3....................................................................

Biology
2 answers:
kotykmax [81]3 years ago
7 0
I would probably go with 2
Tema [17]3 years ago
3 0
I agree option number two...
You might be interested in
Which of the following statements is true?
choli [55]

Answer:

D. Over fifty chemicals in tobacco are known to cause cancer.

Explanation:

Eating disorders like anorexia and bulimia can affect both boys and girls.

Any form of tobacco is dangerous.

Alcohol is definitely responsible for more than 10% of fatal automobile accident.

6 0
4 years ago
Read 2 more answers
Membrane bound space for temporary storage in cell.
lys-0071 [83]
Vacuoles are essentially sacs surrounded by a membrane. They are used by cells as temporary storage sites. They often store food, enzymes, and other materials needed by the cell, and some vacuoles store waste products.
3 0
4 years ago
Arsenic does not have any valence electrons in the 3d orbital because
andrezito [222]

Answer:

it's 3d orbital is completely filled.

Explanation:

3 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Where is most of the mass an a atom
Nadya [2.5K]

Explanation:

nucleus

Over 99.9 percent of an atom's mass resides in the nucleus. The protons and neutrons in the center of the atom are about 2,000 times heavier than the electrons orbiting around it.

hope it helps!

7 0
3 years ago
Other questions:
  • In cellular respiration, stored chemical energy in
    15·1 answer
  • Kristopher is a forensic investigator trying to identify a child victim’s parents. He uses a Punnett square to determine the par
    15·2 answers
  • The crocodile, which can remain under water without breathing for up to one hour, drowns its air-breathing prey and then dines a
    9·1 answer
  • What is the purpose of the turbines in coal fired power plant?
    5·1 answer
  • Which process helps to preserve the genetic information stored in DNA during DNA replication?
    8·1 answer
  • Does age affect where languauge affects the parts of the brain
    7·1 answer
  • Which phylum do sand dollars belong in?
    13·2 answers
  • Which statement best describes the term biodiversity?
    6·1 answer
  • If an organism is 2n=54, how many chromosomes will be in each if it's gametes?
    5·1 answer
  • What is cell ??<br><br>ASAP. please​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!