1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergij07 [2.7K]
3 years ago
5

HELP EXAM ON A TIMER

Biology
2 answers:
velikii [3]3 years ago
7 0
The answer should be Non banded grains
Inessa05 [86]3 years ago
5 0

Answer:

non

Explanation:

You might be interested in
Prior to phytoremediation the concentration of Cd in the soil was: Prior to phytoremediation the concentration of Cd in the soil
zhenek [66]

Answer:

The correct answer is - option B. 19 mg/kg soil.

Explanation:

Phytoremediation is a process of the bioremediation that uses different plants to transfer, remove or destroy the contaminants from the soil. Cd is one of the contaminants that are removed or destroyed by the process of the phytoremediation.19 mg/kg soil is the concentration was available in the soil prior to the phytoremedaition took place.

Thus, the correct answer is - option B.

8 0
3 years ago
Select all that apply. Which of the following are not properties of enzymes
AlladinOne [14]
Enzymes are proteins that are biological catalysts

They reduce the activation energy required for a reaction to occur and thus speed up a reaction

Temperature, above a certain point (optimum temperature) causes them to break down and they are gradually destroyed (denaturing)

They work best at a particular pH (optimum pH) and are once again destroyed by low or high pH's

They have a specific shape, with one particular part, known as the active site, that is specific to the substrate they speed the reaction of. These means they are specific to one type of reaction.

They aren't used in the reaction so they're re-usable.

If it isn't one of these then it is not one of the properties of enzymes
7 0
3 years ago
Uncontrolled cell division can cause all of the following problems except -
UNO [17]
<span>A)produce malignant tumors</span>
5 0
3 years ago
Read 2 more answers
DO NOT SEND ME PDFS!!!!!! Answer with a paragraph
Andrews [41]

short whiskers and short whuskers

7 0
4 years ago
The thymus functions strictly in maturation of t cells. the thymus functions strictly in maturation of t cells.
Scorpion4ik [409]
That is true. <span>The thymus functions strictly in maturation of t cells.</span>
3 0
4 years ago
Other questions:
  • A biologist studying a desert ecosystem observes that the population of a lizard species increases following particularly hot, d
    8·1 answer
  • 50 POINTS!!!! Heart disease is the leading cause of death among both men and women in the United States. It is usually caused wh
    10·1 answer
  • The network of neurons surrounding the central core of the brain that includes the hypothalamus, amygdala, and hippocampus is th
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Is water stored on earth and carbon cycle?
    8·1 answer
  • How does the cell use the charge differences that build up across the inner mitochondrial membrane during cellular respiration?
    12·1 answer
  • ONLY ONE ANSWER!!!
    7·2 answers
  • What does ice become when it absorbs enough heat energy?
    13·2 answers
  • Need help ASAP please!
    13·1 answer
  • Why does your arm feel numb if you put too much pressure on it?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!