1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
12345 [234]
3 years ago
5

Select all that apply. Cell structures that plant and animal cells don't share are _____.

Biology
2 answers:
olga_2 [115]3 years ago
5 0
A cell wall. Animal cells do not have a cell wall have plants have a cell wall.
34kurt3 years ago
3 0
They don't share a cell wall
You might be interested in
Iced tea mix is stirred into water until it dissolves . which statements are true?
Ray Of Light [21]
A. because the iced tea mix dissolves in the water therefore it is a solvent <span />
6 0
2 years ago
Genetic diversity is ultimately/mainly the result of _______________
RUDIKE [14]

Answer:

A. meiosis.

Explanation:

Meiosis is one of the two major types of cell divisions in living organisms. Meiosis is the process by which four daughter cells that are genetically different from the parent cell are produced. Meiotic process is carried out solely during sexual reproduction to yield gametes or sex cells.

The gametes have their chromosomal number reduced by half during the process. However, one immense importance of meiosis is that it PROMOTES GENETIC DIVERSITY. A process called crossing over, which is the exchange of chromosomal segment between non sister chromatids, makes this possible.

7 0
2 years ago
What is the definition of a lake?
Cerrena [4.2K]
<span>a large body of water surrounded by land.</span>
5 0
3 years ago
Not too sure about this question ↑ ​
Mashutka [201]

Answer:

the umbilical cord is connected to both the mother and the unborn child and so tranfers nutrients from the mothers blood to that of the baby's blood

7 0
3 years ago
Read 2 more answers
(My kingdom for a shoe! Sam's biology teacher instructed the class to throw their shoes in a pile. Based on shoe characteristics
Brilliant_brown [7]

Answer:

I think the answer is B

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • A hypothetical poison prevents nucleoli from carrying out their functions which organelles would be affected by this poison what
    9·1 answer
  • 25. A post-doctoral research student is working with a culture of bacteria that doubles in size every 72 hours. The initial popu
    10·1 answer
  • How do the wrinkles of the brain make the brain more efficient
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The different from of a gene for a given trait are called
    13·2 answers
  • Why do most biologists believe that true commensalism does not exist?
    9·2 answers
  • If you palpate the bony projection on the lateral side of your wrist, just proximal to the thumb, what part of the radius are yo
    11·1 answer
  • The diagram shows different forms of thermal energy transfer. What do the flames below the pot represent?
    9·1 answer
  • 1 State whether the following statements are True or False.
    5·1 answer
  • Use the gel below to determine your double stranded segment of DNA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!