1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rainbow [258]
3 years ago
7

Is the cell membrane in bacteria?

Biology
2 answers:
Contact [7]3 years ago
5 0
The answer is no. Hope it helps :)
Hitman42 [59]3 years ago
3 0

Answer:

Explanation:

You might be interested in
This animal represents what kind of body symmetry?
Alenkinab [10]

Answer:

Bilateral symmetry

Explanation:

the property of being divisible into symmetrical halves on either side of a unique plane. I am pretty sure itis this one, hope i helped you!

5 0
2 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which would make for a weak claim?
levacccp [35]

Answer:

A blog cited as a source

Explanation:

Blogs often contain opinions rather than facts

6 0
3 years ago
Read 2 more answers
Compare and contrast the structure and function of the anterior and posterior pituitary glands. drag the appropriate items to th
borishaifa [10]
Anterior Pituitary or adenohypophysis has two parts: pars distalis and pars intermedia..though they are kinda joined in humans.
•Pars distalis (actuallyknown as the anterior pituitary) secretes hormones like Growth Hormone or Somatotrophin, Prolactin, TSH, ACTH,LH,FSH.
•Pars intermedia secretes only one hormone MSH (Melanocyte Stimulating Hormone)
•Posterior pituitary or Neurohypophysis stores two hormones (originally secreted by the hypothalamus) which are Oxytocin and Vasopressin or ADH.

Cheers..dont forget to deem this answer as a brainy answer :)
5 0
3 years ago
What causes the ripples to form?
ivanzaharov [21]

Answer:

Ripples in water are more formally known as capillary waves, and are caused by the subtle interaction of wind and water, or the physical interaction of the water with another object.

7 0
2 years ago
Other questions:
  • What is the expected hematocrit level in a woman with polycythemia?
    10·1 answer
  • What does phontosynthesis really means?
    13·2 answers
  • Which statement best compares pseudopods in sarcodina and flagella in dinoflagellates?
    15·1 answer
  • ¿Cual es la técnica que se utiliza para identificar si una mezcla es una solución?
    13·1 answer
  • Bacteria, like the Lactobacillus acidophilus use sugar as an energy source for anaerobic cellular respiration. This process prod
    8·2 answers
  • Which of these is the study of human population size and the factors that influence it?
    15·1 answer
  • An organ that helps break down food but is not part of the tube through which the foodstuffs pass is referred to as a(n) _______
    5·1 answer
  • A cell will use this type of division when it needs to produce exact copies of itself. What is it? ​
    8·1 answer
  • Keystone predators often help maintain ecological stability in a community if they
    11·1 answer
  • The red shift of some clusters and pairs of galaxies give certain discrete values, or discrete quantum levels.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!