1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stells [14]
3 years ago
13

Place the following organisms in order from producer to primary consumer to secondary consumer to tertiary consumer:

Biology
1 answer:
arlik [135]3 years ago
5 0
Alfalfa
Rabbit
Coyote
Wolf
You might be interested in
Which currents carry warm water away from the equator?
bixtya [17]
The answer top the question given above is letter c. Surface currents.
There are two types of ocean currents, surface current and deep currents. 
Surface currents which are caused by winds,move warm water away from the equator and cool water away from the poles. Deep currents on the other hand are driven by differences in water density.
4 0
3 years ago
Describe how the DNA in a cauliflower plant is similar to and different from the DNA in Brussels sprouts.
timofeeve [1]

Answer:

Cabbage is a different story. Per capita consumption of it peaked way back in the 1920s, when the average American ate 22 pounds of it per year. Nowadays, we eat about eight pounds, most of it disguised as cole slaw or sauerkraut.

This makes it pretty interesting that kale and cabbage — along with broccoli, Brussels sprouts, cauliflower, collard greens, and kohlrabi, and several other vegetables — all come from the exact same plant species: Brassica oleracea.

In some circles, kale has become really, really popular. Once a little-known speciality crop, its meteoric rise is now the subject of national news segments. Some experts are predicting that kale salads will soon be on the menus at TGI Friday's and McDonald's.

6 0
2 years ago
Which are structures of the excretory system? Check all that apply. kidney spleen bladder liver ureter urethra
mina [271]
What are your choices

5 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
BRAINLIESTTTTTT ASAP! :)
meriva

Active transport require the cell to expand energy whilst Passive transport require no energy from the cell in active transport.

Passive Transport moves molecules across membrane without the use of energy by the cell.

-Simple diffusion

-Facilitated diffusion

-Osmosis

Active Transport uses energy (ATP) to move molecules across membrane.

-Protein pumps

-Exocytosis

-Endocytosis (Phagocytosis & Pinocytosis)

5 0
3 years ago
Other questions:
  • An example of chemical digestion is the breakdown of __________ into __________.
    14·1 answer
  • How do seabirds get caught in fishing nets?
    12·2 answers
  • What human body system does your body use to get oxygen into your cells?
    5·1 answer
  • The respiratory pump facilitates the return of blood to the heart by ________.
    14·1 answer
  • Which of the following is noy one of the three major types of rocks?
    10·2 answers
  • What is the process that leaves sediment in a new area called
    14·1 answer
  • What must nonphotosyntheic organism must do to obtain glucose
    6·1 answer
  • Cyanide is a poison that limits the ability of an animal cell to manufacture ATP. In a cell containing a small amount of cyanide
    8·2 answers
  • Does Mars has Oxygen? Can we breath on Mars?​
    15·2 answers
  • How did the results prove the semiconservative model of DNA<br> replication? Explain.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!